We narrowed to 31,165 results for: PLE;
-
Plasmid#209761PurposeAAV virus production for neuonal expression of uMASS (loss-of-function) under hSyn promoterDepositorInsertuMASS_LF
UseAAVExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GH-1
Plasmid#207525PurposeConditionally-replicating in Pseudomonas vector, high-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP;
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-dMASS_LF_WPRE
Plasmid#209766PurposeAAV virus production for neuronal expression of dMASS_LF (loss-of-function) under hSyn promoterDepositorInsertdMASS_LF
UseAAVExpressionMammalianPromoterhSynAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA-Flag-uMASS_1_WPRE
Plasmid#209760PurposeAAV virus production for neuronal expression of uMASS_1 under hSyn promoterDepositorInsertuMASS_1
UseAAVExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-PML peptide
Plasmid#175247PurposeBacterial expression and purification, low affinity SUMOylation substrate with a relatively high Km, can be recruited to FRB with rapamycinDepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP*
Plasmid#175237PurposeBacterial expression and purification, low affinity SUMOylation substrate, point mutation F562A reduces affinity for E2, increasing the KmDepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-E2
Plasmid#175243PurposeBacterial expression and purification, E2 enzyme (UBC9) for SUMOylation, can be recruited to FRB with rapamycin, CyPet acts as a FRET donor to YpetDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-RanGAP
Plasmid#175236PurposeBacterial expression and purification, high affinity SUMOylation substrate that can recruited to FRB with rapamycinDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-V9
Plasmid#173797PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene noctiflora ClpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits