We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#121837PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/KRAB scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IB801: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-KRAB
Plasmid#121823PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
P4-TadCBEd
Plasmid#225143PurposePackaging plasmid for TadCBEd in v3b PE-eVLP architectureDepositorInsertP4-TadCBEd
ExpressionMammalianAvailable SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
gag-TadCBEd
Plasmid#225144PurposePackaging plasmid for TadCBEd in v3 PE-eVLP architectureDepositorInsertMMLVgag-TadCBEd
ExpressionMammalianAvailable SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_T2
Plasmid#184864PurposepSwap plasmid part containing the T2 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSWAP_Entry_T1
Plasmid#184863PurposepSwap plasmid part containing the T1 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDropVn
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAbaMCi-GFP-gfp_pJMP2768
Plasmid#208889PurposeAcinetobacter baumannii CRISPRi test plasmid (GFP, gfp-targeting gRNA).DepositorInsertdCas9, sgRNA expression cassette, sfGFP
ExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFTK056
Plasmid#171328PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertSpCas9-NLS
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK063
Plasmid#171335PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK062
Plasmid#171334PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m2) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK061
Plasmid#171333PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertSpCas9 (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK057
Plasmid#171329PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4)-VPR-NLS
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Fluc-DR
Plasmid#242434PurposeFirefly Luciferse with a Direct Repeat sequence in the 3’UTR recognised by the CasRx under the control of the TRE3G promoter.DepositorInsertFirefly Luciferase
UseCRISPR and LuciferaseTagsCasRx Direct RepeatAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only