We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#187455PurposeHDR donor plasmid to introduce the T804N mutation conferring cellular resistance to ouabain and the EBFP cassette to ATP1A1 intron 17.DepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only
-
LentiGuide-Puro-CTRLg1 (CG509)
Plasmid#139455PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg1
Plasmid#139450PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-CTRLg2 (CG510)
Plasmid#139456PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_T142Q
Plasmid#108110PurposeLentiviral expression plasmid of human SIK3 cDNA (gatekeeper mutation) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange Threonine 142 to GlutaminePromoterEFS promoterAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSIP103: pTarget(CyCAST)
Plasmid#200849PurposeTarget plasmid containing CyPSP1 and attachement site for CyCAST.DepositorInsertsPAM for CyCAST + CyPSP1
tRNA-Leu
ExpressionBacterialAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_BbsI(GGA)
Plasmid#231362PurposeminBG-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231363PurposePle155-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_095
Plasmid#180524PurposedCas9 KTK compatible plasmid. Contains dCas9 and lacZ dropout region with flanking D1.1 overhangs for insertion of gRNA expression assemblyDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE3 (minus strand)
Plasmid#91845PurposeLuciferase reporter for CD69 enhancer (IGI-P0622)DepositorInsertCD69 CaRE3 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationMissing 1 base from 13 base polyT tract beginning…Available SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only