We narrowed to 14,780 results for: sta
-
Plasmid#121856PurposepMVP destination vector, empty expression vector backbone w/ Puro selection cassetteDepositorTypeEmpty backboneUsePmvp gateway destination vectorExpressionMammalianAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1(+)/CUG-nLuc-3XFLAG-CL1/PEST
Plasmid#127316PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from CUG start codonDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/ACG-nLuc-3XFLAG-CL1/PEST
Plasmid#127318PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from ACG start codonDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/GGG-nLuc-3XFLAG-CL1/PEST
Plasmid#127321PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from GGG start codon (Negative control plasmid)DepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
GHR1 X017_pECIA14
Plasmid#114847PurposePrey vector GHR1 X017_pECIA14 should be used with bait vector GHR1 X017_pECIA2.DepositorAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
ERECTA C6_pECIA2
Plasmid#115127PurposeBait vector ERECTA C6_pECIA2 should be used with prey vector ERECTA C6_pECIA14.DepositorInsertAT2G26330 (ER Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-human-BNIP3 delta Exon2
Plasmid#100782PurposeMammalian expression of BNIP3 delta Exon2 splice variantDepositorInserthuman-BNIP3 delta Exon2 (BNIP3 Human)
TagsHAExpressionMammalianMutationExon2 deletionPromoterCMVAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_2] (GB1205)
Plasmid#75406PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_2]) of a polycistronic tRNA-gRNA regulated by the dicot U6-26 or U6-1 promoter (3-part multiplexing)DepositorInserttRNA-gRNA
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc-XPLN aa452-526
Plasmid#73381PurposeExpresses amino acids 452-526 of XPLN (Arhgef3) proteinDepositorInsertarhgef3 (ARHGEF3 Human)
TagsMyc (QKLISEEDL)ExpressionMammalianMutationExpresses amino acids 452-526 of XPLN (arhgef3) p…PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc-XPLN aa304-466 (PH)
Plasmid#73380PurposeExpresses amino acids 304-466 of XPLN (Arhgef3) proteinDepositorInsertarhgef3 (ARHGEF3 Human)
TagsMyc (QKLISEEDL)ExpressionMammalianMutationExpresses amino acids 304-466 of XPLN (arhgef3) p…PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc-XPLN aa107-311
Plasmid#73379PurposeExpresses amino acids 107-317 of XPLN (Arhgef3) proteinDepositorInsertarhgef3 (ARHGEF3 Human)
TagsMyc (QKLISEEDL)ExpressionMammalianMutationExpresses amino acids 107-317 of XPLN (arhgef3) p…PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PBG-WPRE-hGH
Plasmid#74287PurposepAAV vector to express PBG (chimeric Glycoprotein) in a Cre-dependent mannerDepositorInsertPBG (chimeric rabies Glycoprotein)
UseAAVPromoterEf1aAvailable sinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
2.3 hA33 luciferase
Plasmid#68148Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -2270 relative to ATGPromoterhuman GPA33 promoterAvailable sinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM3-K83A
Plasmid#58401PurposeExpresses murine IFITM3-K83A with an N-terminal HA tag in mammalian cellsDepositorInsertIFITM3 (Ifitm3 Mouse)
TagsHAExpressionMammalianMutationLysine 83 to AlaninePromoterCMV IEAvailable sinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM3-K24A
Plasmid#58400PurposeExpresses murine IFITM3-K24A with an N-terminal HA tag in mammalian cellsDepositorInsertIFITM3 (Ifitm3 Mouse)
TagsHAExpressionMammalianMutationLysine 24 to AlaninePromoterCMV IEAvailable sinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Mevalonate diphosphate decarboxylase (MDD)
Plasmid#52431Purposebacterial expression of human Mevalonate diphosphate decarboxylase (MDD)DepositorAvailable sinceApril 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC
Plasmid#47364PurposeBmal fragment cloned with Venus tag and used for BiFCDepositorAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmalc4x_V426F_TEV
Plasmid#47702PurposeExpresses MBP myocilin olfactomedin domain fusion protein with a TEV protease recognition sequence and the mutation V426FDepositorInsertOlfactomedin-like domain with V426F mutation (MYOC Human)
TagsMBPExpressionBacterialMutationchanged V426FPromoterPtacAvailable sinceSept. 9, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits