We narrowed to 5,551 results for: crispr cas9 grna plasmid
-
Plasmid#241724PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BSD marker for selection on blasticidin SDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pBHM2678
Plasmid#241723PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BLE marker for selection on phleomycinDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2680
Plasmid#241725PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BSR marker for selection on blasticidin SDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_835
Plasmid#245327PurposeCas9 CRISPRko positive control guide; targets CD59DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSGAb-km
Plasmid#121999PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSGAb-spe
Plasmid#122000PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only