We narrowed to 26,679 results for: lars
-
Plasmid#216467PurposeEmpty integration vector for genomic integration for multigene into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pPOM041_P15678_SingleGeneBackbone
Plasmid#216466PurposeEmpty integration vector for genomic integration of 1 transcriptional unit into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM032_P4_tSynth30
Plasmid#216457PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth30
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM031_P4_tSynth29
Plasmid#216456PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth29
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM030_P4_tSynth27
Plasmid#216455PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth27
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM029_P4_tSynth25
Plasmid#216454PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth25
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM028_P4_tSynth3
Plasmid#216453PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM027_P4_tSynthGuo
Plasmid#216452PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator guo
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM025_P2_pTUP11
Plasmid#216450PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tup11
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM023_P2_pAPL4
Plasmid#216448PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter apl4
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM021_P2_pTUB1
Plasmid#216446PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tub1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM018_P2_pRPL701
Plasmid#216443PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rpl701
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM017_P2_pTIF51
Plasmid#216442PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tif51
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM016_P2_pRPL2501
Plasmid#216441PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rpl2501
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 1
Plasmid#207609PurposesgRNA 1 to knockout TR by replacement with a PuroR cassetteDepositorInsertACCCTAACTGAGAAGGGCGT
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT87
Plasmid#204489PurposeCAG promoted WBeta recombinaseDepositorInsertWBeta recombinase
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCAGAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only