We narrowed to 10,674 results for: yeast
-
Plasmid#117667PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-alphaf(I)-Btl2
ExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-P525L-YFP
Plasmid#29628DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-C (LEU2)
Plasmid#177796PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneTagsDHFR F[3]ExpressionYeastPromoterADH1Available SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneTagsDHFR F[1,2]ExpressionYeastPromoterADH1Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM-TagRFP657
Plasmid#176563PurposeExpression of TagRFP657 for auxotrophic selection in the absence of methionineDepositorInsertTagRFP657
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-p53
Plasmid#133900PurposePositive control when used in combination with pAWH-largeT. Expression of Gal4BD-p53 hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP38-AtLEA4-5
Plasmid#178189PurposeSED1 biosensor for expression in Saccharomyces cerevisiaeDepositorInsertSED1 biosensor
ExpressionYeastPromoterpPMA1Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYTRW09K_0T5
Plasmid#177281Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEINO1
Plasmid#179472PurposeMulti-host shuttle plasmid for D. radiodurans, E. coli, S. cerevisiae, S. meliloti, and P. tricornutum; contains an oriT for transfer via conjugationDepositorInsertsori
cat
UseSynthetic Biology; Bacterial and yeast cloningAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEW108
Plasmid#232823PurposeExpresses yeast compass complex in insect cellsDepositorInsertTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationSet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC-BAR-YR
Plasmid#61766PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing bar gene (for resistance against glufosinate ammonium) on transfer DNA (TDNA).DepositorInsertsBar gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromotertrpC promoterAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
yHS1-M7A,H102A
Plasmid#159152PurposeCytosolic labile heme reporterDepositorInsertyHS1-M7A,H102A
ExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYTRW26K_1Ti1
Plasmid#177292Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and eYFPDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTSK01K_0G7
Plasmid#177296Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmRDepositorInsertPaacC1-aacC1
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins2
Plasmid#195039PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC-SUR-YR
Plasmid#61768PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing sulfonylurea resistance gene (ILV alelle from Magnaporthe oyrzae) on transfer DNA (TDNA).DepositorInsertsSur gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromoterMagnaporthe oryzae ILV promoterAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS-mEmerald-VIM
Plasmid#62849PurposeDonor vector for gene editing at human VIM locusDepositorInsertmEmerald-VIM (VIM Human, Synthetic)
UseYeast-e.coli shuttle vectorAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only