We narrowed to 36,026 results for: CaS
-
Plasmid#47594DepositorInsertPMCA4bct125 (ATP2B4 Human)
TagsEGFPExpressionMammalianMutation125 C terminal AA deletedPromoterCMVAvailable SinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-ZNF865-UbC-DsRed-P2A-Bsr
Plasmid#241309PurposeLentiviral SpCas9-gRNA (ZNF865) expression vector with DsRed-Express2-P2A-BlastRDepositorInsertZNF865 gRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ12-PB-U6-ND1-acti-gRNA1
Plasmid#131056PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ13-PB-U6-ND1-acti-gRNA2
Plasmid#131057PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ14-PB-U6-ND1-acti-gRNA3
Plasmid#131058PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_031
Plasmid#245331PurposeCas12a CRISPRko all-in-one positive control; targets CD47, CD63DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_245
Plasmid#245332PurposeCas12a CRISPRko positive control guide; targets CD46DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_837
Plasmid#245328PurposeCas9 CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_247
Plasmid#245334PurposeCas12a CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA097
Plasmid#245319PurposeCas12a CRISPRko positive control; targets CD46, CD47, CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695&MosU6.syn_3xP3-DsRed1-SV40 (Tandem 2_2 gRNAs)
Plasmid#243013PurposeFor cloning two gRNAs in tandem after BspQI digestion under An. gambiae U6.695 and U6.MosU6syn (synthetic mosquito U6) promoters.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only