We narrowed to 16,278 results for: nes
-
Plasmid#23076DepositorPublicationInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H4 changed Lysines 5 and 12 to Arginines,…Available sinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBBK02 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitKanR, AmpR)
Plasmid#178986PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK06 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitNatR,AmpR)
Plasmid#178990PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitNourseothrycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJSC176 - Bacterial expression plasmid for SpCas9 + Q926A variant
Plasmid#101206PurposeBacterial expression plasmid for SpCas9 + Q926A variantDepositorInsertSpCas9 variant Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationQ926APromoterT7Available sinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
HeFm1SpCas9
Plasmid#92110PurposeExpression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX ALIX-GFP S718/721A
Plasmid#138583PurposeExpresses fluorescent ALIX S718/721A in mammalian cellsDepositorInsertALIX (PDCD6IP Human)
UseLentiviralTagsGFP and h30ExpressionMammalianMutationchanged serines 718 and 721 to alaninesPromoterTREtightAvailable sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_GFPsp
Plasmid#212144PurposePreparatory plasmid for operon integration into the genome using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC, green fluorescent protein
ExpressionBacterialPromoterpJ23119Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_GFPsp_CamRcargo
Plasmid#212143PurposePreparatory plasmid for gene disruption into the genome using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC, green fluorescent protein
ExpressionBacterialPromoterpJ23119Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F48
Plasmid#23072DepositorPublicationInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 14 to Glutamine, H3 K14…Available sinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F50
Plasmid#23074DepositorPublicationInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 14 to Arginine, H3 K14R…Available sinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F54
Plasmid#23078DepositorPublicationInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 9 to Glutamine, H3 K9Q …Available sinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
AP70_pU.CAG.Cas9-D10A-K848A-R1060A.rBGpA
Plasmid#199254PurposeExpression construct encoding the high specificity SpCas9-KARA-D10A nickaseDepositorInsertHigh specificity S. pyogenes Cas9-D10A-KARA nickase
UseCRISPRTags3XFLAG epitope, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationD10A K848A R1060APromoterCAG promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET26b(+)-SpnA_90-876_C to S
Plasmid#259974PurposeExpresses SpnA mutant C729SDepositorInsertnuclease A
Tags6xHis-HA-StrepII-TEV (histidine–hemagglutinin–Str…ExpressionBacterialMutationChanged Cysteine 729 to Serine and truncated SpnA…PromoterT7 PromoterAvailable sinceSept. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-GNAS
Plasmid#249456PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBBK09 pCAS-Tyr-[gRNA: BsaI GFP dropout] (BsmBI-flanked URA3, AmpR)
Plasmid#178993PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = URA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_163 SpCas9 K233A/K234A/K253A/K263A
Plasmid#179527PurposeFor bacterial expression of SpCas9 K233A/K234A/K253A/K263A (helix-rolling basic patch mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 K233A/K234A/K253A/K263A
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged lysines 233, 234, 253, and 263 to alanineAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only