We narrowed to 12,237 results for: nsf
-
Plasmid#208662PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0 in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0
UseAAVPromoterEFSAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.CD86.C-HA
Plasmid#154848PurposeExpresses murine CD86 protein (T-lymphocyte activation antigen) with HA-tag at C-terminusDepositorInsertCluster of Differentiation 86 (Cd86 Mouse)
UseAAVTagsHA-tagExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET51b-Strep-hAGT-His
Plasmid#167276PurposeOverexpression of the human o_-alkylguanine-dna alkyltransferase in E. coliDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-500-WPRE
Plasmid#174134PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-500 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-Bat-CoV-HKU9-3CL-C144A
Plasmid#160285PurposeAllows for constituitive mammalian expression of the Bat-CoV-HKU9 3CL protease with C145A mutation via transfection or lentivirusDepositorInsert3CL Protease
UseLentiviralExpressionMammalianMutationC144APromoterEF1aAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184V
Plasmid#106190PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterCAGAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
scAAV-TTR-mFgf15
Plasmid#190594PurposeAAV construct containing Fgf15 cds under control of TTR promoterDepositorAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S1-jRCaMP1a
Plasmid#160728PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains RFP-based fluorescent reporter jRCaMP1a (calcium indicator), Xpress tag, and S1 protein scaffold.DepositorInsertS1-jRCaMP1a
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_iChloC_CA_Citrine
Plasmid#98220PurposeSlow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with blue to green light, inactivation max with 605 nm (accelarates closure to ms). Codon optimized for mammalian expression.DepositorInsertSynthetic construct iChloC_C128A gene
UseAAVTagsCitrineExpressionMammalianMutationE83Q, E90R, E101S, C128A, T159C, D156NPromoterhuman synapsinAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.SF-Venus-iGluSnFR.S72A
Plasmid#106179PurposeWeak affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.S72A
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: S72APromoterhSynapsinAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS1830 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-U6-Fah
Plasmid#199263PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCU-tDimer
Plasmid#181865PurposeExpresses tDimer-tagged mitochondrial calcium uniporter (MCU) under control of the CaMKIIa promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV and AdenoviralTagstDimerExpressionMammalianPromoterCaMKIIaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-bREACHes-EYFP
Plasmid#137147PurposeIntersectional viral expression of bREACHes-EYFP in cells expressing Flp AND NOT CreDepositorInsertCoff/Fon-bREACHes-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
Plasmid#140203PurposeFungal vector to express an LbCas12a crRNA array targeted to Pelca, to be contransformed with pCRI009 containing PelcA-mCherry in a dLbCas12a-VPR strain as proof-of-concept of CRISPRa.DepositorInsertcrRNA array elcA
UseCRISPR and Synthetic BiologyPromoterPgpdAAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
mOrange-P2A-hKvb1
Plasmid#154084PurposeIndependent expression of mOrange and human Kvbeta 1 under human synapsin 1 promoterDepositorInsertmOrange-P2A-human Kvb1 (KCNAB1 Synthetic, Human)
UseAAVExpressionMammalianPromoterhuman synapsin 1Available SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
rd-his
Plasmid#112911PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tag and non-cleavable C-terminal 6-his tagDepositorInsertdematin (DMTN Human)
Tags6-his tag, Glutathione-S-Transferase, and preciss…ExpressionBacterialMutation89KSTSPPPSPEVWAD102 was replaced with 89KAAAGGGAG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-ChR2-YFP
Plasmid#178725PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only