-
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Lats1 (Nigg HS189)
Plasmid#41156DepositorInsertLats1 (LATS1 Human)
UseTags3xMyc and PreScission SiteExpressionMammalianMutationPromoterCMVAvailable sinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVTagsExpressionMammalianMutationPromoterhSyn1Available sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4
Plasmid#184887PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM8,13
Plasmid#170282PurposeExpresses both yeast Tim8 and yeast Tim13 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim8 and Tim13 (TIM8 Budding Yeast)
UseTagsTEV-cleavable N-terminal His tag on Tim13 (on bac…ExpressionBacterialMutationPromoterAvailable sinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS2
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Syn-ATP
Plasmid#51819PurposeOptical reporter of presynaptic ATPDepositorInsertChimeric Synaptophysin-mCherry-Luciferase
UseTagsExpressionMammalianMutationWithin WT luciferase gene, changed Threonine 214 …PromoterCMVAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorInserthsTRPA1 (TRPA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionTagsExpressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CPH3486 (YCp LEU2 Rpb1 F1492A)
Plasmid#91808PurposeYeast expression of S. cerevisiae Rpb1 with a F1492A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged phenylalanine 1492 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3487 (YCp LEU2 Rpb1 S1493A)
Plasmid#91809PurposeYeast expression of S. cerevisiae Rpb1 with a S1493A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged serine 1493 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3488 (YCp LEU2 Rpb1 P1494A)
Plasmid#91810PurposeYeast expression of S. cerevisiae Rpb1 with a P1494A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged proline 1494 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3508 (YCp LEU2 Rpb1 Y1473A)
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3509 (YCp LEU2 Rpb1 T1471A)
Plasmid#91812PurposeYeast expression of S. cerevisiae Rpb1 with a T1471A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged threonine 1471 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only