We narrowed to 35,668 results for: JUN
-
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD2 HRD
Plasmid#207078PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL661-TTTA
Plasmid#215865PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL661 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-EGFP12-TTTA
Plasmid#215857PurposeThis plasmid encodes sgRNA that target EGFP with stretch sequenceDepositorInsertsgRNA-EGFP12 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL714-TTTA
Plasmid#215867PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL714 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only