We narrowed to 1,911 results for: sfGFP
-
Plasmid#163734PurposeLactate-inducible expression of green fluorescent protein encoding two opal codonsDepositorInsertlldr gfp.2TGA
ExpressionBacterialMutationgfp with first two leucine codons mutated to amberAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-SZ158a-sfGFP
Plasmid#162446PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptorsDepositorInsertC-X-C chemokine receptor type 4 (CXCR4 Human)
TagssfGFPExpressionMammalianMutationtruncation from aa52 to aa257PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-AKAR (mScarlet-I)
Plasmid#181861PurposeFluoSTEP-AKAR using mScarlet-I as the FRET acceptor.DepositorInsertFluoSTEP-AKAR (mScarlet-I)
TagsmScarlet-I and sfGFP(1-10)ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJBL-RNAINS4
Plasmid#69456PurposeRNA-IN S4 variant 5' UTR sequence controlling expression of superfolder GFP (UTR sequence from Mutalik et al., Nat. Chem. Biol., 2012)DepositorInsertRNA-IN S4 + SFGFP
UseSynthetic BiologyExpressionBacterialMutationmutations for S4 variant (from wt)PromoterJ23119 and J23119 (sigma 70)Available SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a(R887E)-DNMT3l
Plasmid#154141PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianMutationR887EPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM11-SUMO3- sfGFP-KSR1-CA3 (N-KSR)
Plasmid#217767PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
plenti.CamKII.(synapto).cpsfGFP.miRFP670nano3
Plasmid#214926PurposeExpresses presynaptic non-responsive controlDepositorInsert(synapto).cpsfGFP.miRFP670nano3
UseLentiviralExpressionMammalianPromoterCamKIIAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.(cyto).cpSFGFP.HaloTag
Plasmid#209666PurposeNon-responsive controlDepositorInsertcpSFGFP.HaloTag
UseAAVPromoterhSynAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSSCPG
Plasmid#183187PurposePACE-evolved split N (core) terminal of T7 RNA polymerase-SpmXΔC and SpmXΔC-PACE-evolved split C (sigma) terminal of T7 RNA polymerase both expressed under Tac promoter; sfGFP-LAA expressed under T7 pDepositorInsertssuperfolder GFP
SpmX450 and T7 181+ fusion protein
T7 RNAP 1-179 variant and SpmX450 fusion protein
mRFP1 and popZ fusion protein
ExpressionBacterialAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-msfGFP
Plasmid#180322Purposemammalian expression of human SEPT9_i3 fused to monomeric superfolder GFPDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFNMB1-msfGFP
Plasmid#113191PurposeMobilizable plasmid for tetracycline inducible gene expression in Francisella novicidaDepositorInsertmsfGFP
Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT2-msfGFP
Plasmid#180318Purposemammalian expression of human SEPT2 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB_EF1a-DjCas13d-msfGFP-Blast
Plasmid#226008PurposeDjCas13d protein for RNA targeting in piggyBac backboneDepositorInsertDjCas13d RNA-targeting nuclease
UseCRISPRTagsmsfGFPExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dot1LCD-CatMut
Plasmid#235591PurposeDox-inducible expression of control catalytic-mutant Dot1l CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Setd2CD-CatMut
Plasmid#235588PurposeDox-inducible expression of control catalytic-mutant Setd2 CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR)
Plasmid#217766PurposeFluorescent reporter for ceramide (for bacterial expression and purification)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLEVI(408)-ColE-iLight-msfGFP
Plasmid#170268PurposeExpresses LexA_DBD-iLight-msfGFP under J23116 promoter and mCherry under ColE promoter with a LexA408 operator in bacteria.DepositorInsertiLight
TagsmsfGFPExpressionBacterialMutationTo design iLight for expression in bacteria, a fu…PromoterpJ23116Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UUA)_EF1_sfGFP150TAA
Plasmid#174897Purposeochre suppression reporter sfGFP150TAA expression, with MmaPylT(UUA) ochre suppressor tRNA cassetteDepositorInsertsf GFP
ExpressionMammalianMutation150TAA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-vsfGFP-0
Plasmid#191097PurposeTo express a bright green nanobody FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-vsfGFP-0
UseAAVTagsGreen fluorescent protein bound to enhancer nanob…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only