We narrowed to 43,126 results for: cha
-
Plasmid#170281PurposeExpresses yeast Tim12 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim12 (TIM12 Budding Yeast)
UseTagsTEV-cleavable N-terminal His tag (on backbone)ExpressionBacterialMutationmutated two non-conserved Cys to AlaPromoterAvailable sinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChR2(H134R)-eYFP (AAV PHP.eB)
Viral Prep#127090-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-CAG-DIO-ChR2(H134R)-eYFP (#127090). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-ChR2(H134R)-eYFP plasmid DNA. CAG-driven, Cre-dependent expression of humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFP (Cre-dependent)Available sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVTagsExpressionMammalianMutationPromoterhSyn1Available sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_hsTRPA1_myc_dTom
Plasmid#183179Purposemyc tagged hsTRPA1 used for cell transfectionDepositorInsertsUseTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Lats1 (Nigg HS189)
Plasmid#41156DepositorInsertLats1 (LATS1 Human)
UseTags3xMyc and PreScission SiteExpressionMammalianMutationPromoterCMVAvailable sinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4
Plasmid#184887PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM8,13
Plasmid#170282PurposeExpresses both yeast Tim8 and yeast Tim13 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim8 and Tim13 (TIM8 Budding Yeast)
UseTagsTEV-cleavable N-terminal His tag on Tim13 (on bac…ExpressionBacterialMutationPromoterAvailable sinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4_MP
Plasmid#228358PurposeABE8e-SpCas9-NG Multiplex Acceptor clone for insertion of up to six gRNA cassettes via Golden Gate with BpiI and T4 ligase, blue-white screeningDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS2
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionTagsExpressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
Syn-ATP
Plasmid#51819PurposeOptical reporter of presynaptic ATPDepositorInsertChimeric Synaptophysin-mCherry-Luciferase
UseTagsExpressionMammalianMutationWithin WT luciferase gene, changed Threonine 214 …PromoterCMVAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorInserthsTRPA1 (TRPA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CPH3486 (YCp LEU2 Rpb1 F1492A)
Plasmid#91808PurposeYeast expression of S. cerevisiae Rpb1 with a F1492A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged phenylalanine 1492 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only