We narrowed to 10,223 results for: yeast
-
Plasmid#227992PurposeExpresses BASU-FRB fusion from ADH1 promoter; yeast BioIDDepositorInsertBASU-FRB
TagsHA tagExpressionYeastPromoterADH1Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-ADH1p- BASU-FKBP-HA3
Plasmid#227994PurposeExpresses BASU-FKBP fusion from ADH1 promoter; yeast BioIDDepositorInsertBASU-FKBP
TagsHA tagExpressionYeastPromoterADH1Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-ADH1p-mTID-FRB-HA3
Plasmid#228000PurposeExpresses miniTurboID-FRB fusion from ADH1 promoter; yeast BioIDDepositorInsertminiTurboID-FRB
TagsHA tagExpressionYeastPromoterADH1Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-ADH1p-mTID-FKBP-HA3
Plasmid#228002PurposeExpresses miniTurboID-FKBP fusion from ADH1 promoter; yeast BioIDDepositorInsertminiTurboID-FKBP
TagsHA tagExpressionYeastPromoterADH1Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-HIS3p-TID-FRB-HA3
Plasmid#228004PurposeExpresses TurboID-FRB fusion from HIS3 promoter; yeast BioIDDepositorInsertTurboID-FRB
TagsHA tagExpressionYeastPromoterHIS3Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-CHA1p-TID-FKBP-HA3
Plasmid#228014PurposeExpresses TurboID-FKBP fusion from CHA1 promoter; yeast BioIDDepositorInsertTurboID-FKBP
TagsHA tagExpressionYeastPromoterCHA1Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-MET25p-TID-FRB-HA3
Plasmid#228016PurposeExpresses TurboID-FRB fusion from MET25 promoter; yeast BioIDDepositorInsertTurboID-FRB
TagsHA tagExpressionYeastPromoterMET25Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-MET25p-TID-FKBP-HA3
Plasmid#228018PurposeExpresses TurboID-FKBP fusion from MET25 promoter; yeast BioIDDepositorInsertTurboID-FKBP
TagsHA tagExpressionYeastPromoterMET25Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-BASU-HA3-KanMX6
Plasmid#227978PurposeTo insert biotin ligase, BASU, at the C-terminus of genes; yeast BioID, KanMX6 markerDepositorInsertBASU
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 Cyterm-yemiRFP670
Plasmid#219856Purposeexpression of Cyterm-yemiRFP670 in budding yeastDepositorInsertCyterm-yemiRFP670
ExpressionYeastAvailable SinceAug. 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDRF1 Cyterm-ymiRFP680
Plasmid#219854Purposeexpression of Cyterm-ymiRFP680 in budding yeastDepositorInsertCyterm-ymiRFP680
ExpressionYeastAvailable SinceAug. 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPOM032_P4_tSynth30
Plasmid#216457PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth30
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM031_P4_tSynth29
Plasmid#216456PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth29
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM030_P4_tSynth27
Plasmid#216455PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth27
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM029_P4_tSynth25
Plasmid#216454PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth25
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM028_P4_tSynth3
Plasmid#216453PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM027_P4_tSynthGuo
Plasmid#216452PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator guo
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only