We narrowed to 5,526 results for: cmv promoter
-
Plasmid#115139PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Luc2 (FF-Luciferase) R4-R3
Plasmid#62169PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseLuciferase; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hOrf2mor-NLS(sv40) (BPK5095)
Plasmid#115141PurposeCMV-T7 promoter expression plasmid for human codon optimized Orf2mor anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized Orf2mor anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
pKG2438_pGEEC534_pShip-CMV-mRuby2-P2A-PuroR-bGH
Plasmid#239730PurposePlasmid expressing mRuby2 and PuroR with the CMV promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJB002 CMV 3xFLAG-NLS-DsDed-ZF1
Plasmid#161532PurposeConstitutive expression ofCMV 3xFLAG-NLS-DsDed-ZF1 under the CMV promoterDepositorInsert3xFLAG-NLS-DsDed-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-Puro
Plasmid#239953PurposeLentiviral vector to generate MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-LATS1
Plasmid#235689PurposeExpress RFP tagged LATS1 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD8-Puro
Plasmid#239954PurposeLentiviral vector to generate MFSD8 stable expressing cell line under CMV promoterDepositorInsertMFSD8
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-IgK-pHluorin-TM-mRuby
Plasmid#185546PurposeExpresses surface-localized pHluorin fused to intracellular expression of mRuby under CMV promoterDepositorInsertIgK-pHluorin-TM-mRuby
ExpressionMammalianPromoterCMVAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-NFIB-T2A-miRFP670
Plasmid#187222PurposeExpresses human NFIB and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertNuclear Factor I B (NFIB Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA-mTurq2
Plasmid#157772PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA-mTurq2
Plasmid#157768PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV-hCas9 R4-R3
Plasmid#62132PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing CMV promoter and human codon optimized Cas9 module Compatible with MultiSite Gateway cloningDepositorInserthuman codon optimized Cas9
UseCRISPR; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L1-R5
Plasmid#62122PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only