We narrowed to 21,247 results for: CAN
-
Plasmid#112984PurposeP element vector for transposon insertion of mei-S332 5.6Kb genomic DNA into Drosophila genomeDepositorAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only
-
719-2µ-minHIS3
Plasmid#40610DepositorInsertHIS3 (HIS3 Budding Yeast, Synthetic)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypEGFP
Plasmid#153203PurposeCan be used to generate AAV virus that will mark the presynaptic terminal (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertsynaptophysin-EGFP
UseAAVPromoterrat synapsinAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-BbsI-CMV-EGFP cloning vector
Plasmid#239464PurposesgRNA cloning vector with EGFP expression cassette. An sgRNA spacer sequence can be cloned into BbsI sites. A CMV-EGFP expression cassette is included as a reporter of transfection efficiency.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c023
Plasmid#175469PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Can be biotinylated.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
RAB5AA-c006
Plasmid#175476PurposeProtein expression in bacterial cells. GTPase domain, G15-N184. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mScarlet-I
Plasmid#112954PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
CytERM-LSS-SGFP2
Plasmid#112940PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
TagsLSS-SGFP2ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc CDC4 WT*
Plasmid#16652DepositorInsertCDC4 (FBXW7 Human)
TagsmycExpressionMammalianMutation*Note that this insert is only WT relative to the…Available SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro-HA-PIK3CA(H1047R;F486S;del)
Plasmid#33255DepositorInsertPIK3CA (PIK3CA Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationchanged histidine 1047 to arginine and phenylalan…PromoterSV40Available SinceJan. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJEP307-pAAV-EFS(No AgeI)-MCS3-pA
Plasmid#113684PurposeEFS driven Multi Cloning Site-3 without the AgeI restriction enzyme site.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro-HA-PIK3CA(H1047R;G320E)
Plasmid#33254DepositorInsertPIK3CA (PIK3CA Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationchanged histidine 1047 to arginine and glycine 32…PromoterSV40Available SinceJan. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
cmv hTid Short
Plasmid#13709DepositorInserthTid Short (DNAJA3 Human)
ExpressionMammalianAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
cmv hTid Long
Plasmid#13707DepositorInserthTid Long (DNAJA3 Human)
ExpressionMammalianAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pTH743-CEN-RLuc/slowstaCFLuc
Plasmid#38223DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
OmpA3-PNGaseF-TEV-His6
Plasmid#114274PurposeAmidase removing almost all N-linked oligosaccharides from glycoproteins. This PNGase F construct can have its hexa-his removed.DepositorInsertPeptide: N-glycosidase F
TagsOmpA3 leader sequence (for periplasmic localisati…ExpressionBacterialPromoterT7Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only