We narrowed to 10,507 results for: crispr cas9 expression plasmids
-
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-2XNLS-SpCas9-WT-NLS-3XHA-NLS-TALentry
Plasmid#69232PurposeWild type SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dFnCas9
Plasmid#201954PurposeMammalian expression plasmid of dead FnCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dFnCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A and H969A on FnCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIW601-KmCRISPR
Plasmid#98907PurposeK. marxianus CRISPR Plasmid for sgRNA cloningDepositorInsertsCodon optimized Cas9
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsSV40ExpressionYeastAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)
Plasmid#129027Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-mCherry and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
874V=βTub-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159672PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertβTub-NLS-hSpCas9-T2A-GFP
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
874U=ExuL-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159671PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertExuL-NLS-hSpCas9-T2A-GFP
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synmiR-L-mRuby-Pro-dCas9-EGFP-4×17
Plasmid#218268PurposeExpresses dCas9-EGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiRL-mRuby-EF1a-CMVe_MeP-dCas9-EGFP-MREL_4×17
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synmiR-L-mRuby-Pro-dCas9-EGFP-4×19
Plasmid#218270PurposeExpresses dCas9-EGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiRL-mRuby-EF1a-CMVe_MeP-dCas9-EGFP-MREL_4×19
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-2XNLS-SpCas9-WT-NLS-3XHA-NLS-TALentry
Plasmid#69232PurposeWild type SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177344PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterTetracycline-dependent promotersAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177342PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequenceDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1295-AAV-EFSNC-dCjCas9-HP1a(72-177)
Plasmid#223140PurposeExpression of truncated HP1a with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 72-177PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only