We narrowed to 2,549 results for: GCG
-
Plasmid#75930Purpose3rd generation lentiviral gRNA plasmid targeting human MOSDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MOS gRNA (BRDN0001146861)
Plasmid#75931Purpose3rd generation lentiviral gRNA plasmid targeting human MOSDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SBK3 gRNA (BRDN0001146759)
Plasmid#75899Purpose3rd generation lentiviral gRNA plasmid targeting human SBK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIM3 gRNA (BRDN0001145891)
Plasmid#75869Purpose3rd generation lentiviral gRNA plasmid targeting human PIM3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5KL1 gRNA (BRDN0001145139)
Plasmid#75822Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5KL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5KL1 gRNA (BRDN0001148279)
Plasmid#75824Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5KL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK223 gRNA (BRDN0001146707)
Plasmid#75791Purpose3rd generation lentiviral gRNA plasmid targeting human SGK223DepositorInsertSGK223
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SBK1 gRNA (BRDN0001148216)
Plasmid#75799Purpose3rd generation lentiviral gRNA plasmid targeting human SBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK10 gRNA (BRDN0001149099)
Plasmid#75488Purpose3rd generation lentiviral gRNA plasmid targeting human STK10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgGLDC_1
Plasmid#72886PurposeCRISPR-Cas9 induced gene disruptionDepositorInsertsgGLDC
UseLentiviralPromoterCMVAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_cGAS_gRNA_3
Plasmid#235531PurposegRNA against human cGASDepositorInsertcGAS (CGAS Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 IRF3 KO
Plasmid#217446PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human IRF3DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-MGAT1-KO
Plasmid#80009PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.DepositorInsertMGAT1 (MGAT1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKL038 Lenti U6 dCas12a gRNA Puro mCherry
Plasmid#195546PurposedCas12a gRNA expression backboneDepositorInsertLenti U6- empty cassette_Direct repeat_puro_mcherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001487120)
Plasmid#77966Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146194)
Plasmid#75913Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only