8,388 results
-
Plasmid#227605PurposeInducible expression of His-tagged SLC25A46 with I349D mutation in Pichia pastorisDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pPICZ A-Strep-Opa1 (SB251)
Plasmid#227600PurposeInducible expression of Strep-tagged Opa1 in Pichia pastorisDepositorInsertOPA1 (OPA1 Human)
TagsTwin-StrepTagExpressionYeastMutationcontains aa 253-960 onlyPromoterAOX1Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFa6-TID-FKBP-3HA-KanMX6
Plasmid#228024PurposeTo integrate TID-FKBP fusion at yeast promoter; yeast BioID with KanMX6 markerDepositorInsertTurboID-FKBP
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFa6-TID-FKBP-NLS-3HA-KanMX6
Plasmid#228026PurposeTo integrate TID-FKBP-NLS fusion at yeast promoter; yeast BioID with KanMX6 markerDepositorInsertTurboID-FKBP
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-BASU-HA3-KanMX6
Plasmid#227978PurposeTo insert biotin ligase, BASU, at the C-terminus of genes; yeast BioID, KanMX6 markerDepositorInsertBASU
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-BioID2-HA3-KanMX6
Plasmid#227976PurposeTo insert HA-tagged biotin ligase, BioID2, at the C-terminus of genes; yeast BioID, KanMX6 markerDepositorInsertBioID2
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-BirA-HA3-KanMX6
Plasmid#227974PurposeTo insert HA-tagged biotin ligase, BirA, at the C-terminus of genes; yeast BioID with KanMX6 markerDepositorInsertBirA
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
CUP1-∆ssCPY*-mGFP in pRS315
Plasmid#221158PurposeFluorescent reporter for cytoplasmic aggregates under LEU2 selection markerDepositorInsertCarboxypeptidase Y (PRC1 Budding Yeast)
TagsmGFPExpressionYeastMutationDeletion signal peptide, G255A mutationAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
CUP1-∆ssCPY*-mGFP
Plasmid#212197PurposeFluorescent reporter for cytoplasmic aggregatesDepositorInsertCarboxypeptidase Y variant (PRC1 Budding Yeast)
TagsmEGFP (monomeric version EGFP, A206K mutation)ExpressionYeastMutationDeletion signal peptide, G255A mutationPromoterCUP1Available SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41K
Plasmid#194522PurposeLow copy vector backbone with G418 selectivity, contains MCSDepositorTypeEmpty backboneExpressionYeastAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42K
Plasmid#194523PurposeHigh copy vector backbone with G418 selectivity, contains MCSDepositorTypeEmpty backboneExpressionYeastAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41N
Plasmid#194524PurposeLow copy vector backbone with nourseothricin selectivity, contains MCSDepositorTypeEmpty backboneExpressionYeastAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N
Plasmid#194525PurposeHigh copy vector backbone with nourseothricin selectivity, contains MCSDepositorTypeEmpty backboneExpressionYeastAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N-TDH3pr
Plasmid#194531PurposeHigh copy vector backbone with nourseothricin selectivity, contains TDH3(pr)-MCS-CYC1(3'UTR)DepositorTypeEmpty backboneExpressionYeastAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42H-TDH3pr-mNeon
Plasmid#194539PurposeHigh copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.14
Plasmid#188068PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.14)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-TYR
Plasmid#222484PurposeCo-expression of two genes in yeast with FLAG and MYC tags and TYR1 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-MET (V5 and HA)
Plasmid#222490PurposeCo-expression of two genes in yeast with V5 and HA tags and MET15 selectionDepositorTypeEmpty backboneTagsHA and V5ExpressionYeastAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only