8,418 results
-
Plasmid#194528PurposeLow copy vector backbone with G418 selectivity, contains TDH3(pr)-MCS-CYC1(3'UTR)DepositorTypeEmpty backboneExpressionYeastAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pRSII42N-TDH3pr
Plasmid#194531PurposeHigh copy vector backbone with nourseothricin selectivity, contains TDH3(pr)-MCS-CYC1(3'UTR)DepositorTypeEmpty backboneExpressionYeastAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42H-TDH3pr-mNeon
Plasmid#194539PurposeHigh copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.14
Plasmid#188068PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.14)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-TYR
Plasmid#222484PurposeCo-expression of two genes in yeast with FLAG and MYC tags and TYR1 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-MET (V5 and HA)
Plasmid#222490PurposeCo-expression of two genes in yeast with V5 and HA tags and MET15 selectionDepositorTypeEmpty backboneTagsHA and V5ExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-LYS (V5 and HA)
Plasmid#222491PurposeCo-expression of two genes in yeast with V5 and HA tags and LYS2 selectionDepositorTypeEmpty backboneTagsHA and V5ExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-TYR (V5 and HA)
Plasmid#222492PurposeCo-expression of two genes in yeast with V5 and HA tags and TYR1 selectionDepositorTypeEmpty backboneTagsHA and V5ExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-THR (V5 and HA)
Plasmid#222494PurposeCo-expression of two genes in yeast with V5 and HA tags and THR1 selectionDepositorTypeEmpty backboneTagsHA and V5ExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-THR
Plasmid#222479PurposeCo-expression of two genes in yeast with FLAG and MYC tags and THR1 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-ADE
Plasmid#222480PurposeCo-expression of two genes in yeast with FLAG and MYC tags and ADE2 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-ARG
Plasmid#222481PurposeCo-expression of two genes in yeast with FLAG and MYC tags and ARG1 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1561
Plasmid#218626PurposeExpress geraniol synthase (GES), Idi1, and Erg20(F96W, N127W) all with ePTS1 tags and cytosolic Erg20_WT_synthetic homodimerDepositorInsertGES
TagsePTS1ExpressionYeastAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1402
Plasmid#218616PurposeExpress Pex15, Pex22, Pex4, Pex1, and Pex6DepositorInsertPex15
ExpressionYeastAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1577
Plasmid#218619PurposeExpress Pex5, Pex2, Pex17, and Pex10DepositorInsertPex5
ExpressionYeastAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1578
Plasmid#218620PurposeExpress Pex22, Pex6, Pex15, and Pex8DepositorInsertPex22
ExpressionYeastAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSPR24
Plasmid#217309PurposePromoterless (SwaI Cutsite) mRuby3:amdS fusion reporterDepositorInsertAcetamidase
TagsmRuby3ExpressionYeastAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSPR25
Plasmid#217310PurposePromoterless (SwaI Cutsite) mNeonGreen:amdS fusion reporterDepositorInsertAcetamidase
TagsmNeonGreenExpressionYeastAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only