8,418 results
-
Plasmid#232999PurposeGalactose iduced expression of Gcn4 DBDGFP in yeastDepositorInsertDBD
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoAS
Plasmid#232959PurposeGalactose iduced expression of Gcn4 ILVtoAS in yeastDepositorInsertGcn4 ILVtoAS
TagsTEV cleavage siteExpressionYeastMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44merGFP
Plasmid#233000PurposeGalactose iduced expression of Gcn4 WT 44merGFP in yeastDepositorInsertGcn4 WT 44mer
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 30mer
Plasmid#232986PurposeGalactose iduced expression of Gcn4 WT 30mer in yeastDepositorInsertGcn4 WT 30mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS424 Prp8 WT TRP1
Plasmid#234120PurposeThe N-terminus of Prp8 was restored thereby destroying the NheI site and correcting the ORFDepositorInsertPrp8
ExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-NFAPoptim
Plasmid#221110PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-CFAPoptim
Plasmid#221111PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221114PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Tef1 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterTEF1Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-deltaPEST
Plasmid#221118PurposeFAP tagged STE3-PEST mutant (delta413-470 - N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-deltaPEST
ExpressionYeastMutationSTE3 mutant that lacks the PEST domain in the C-t…PromoterSTE3Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-K424R
Plasmid#221119PurposeFAP tagged STE3-K424R mutant (N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-K424R
ExpressionYeastMutationSTE3 mutantK424RPromoterSTE3Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ANP1-FAPoptim
Plasmid#221120PurposeFAP-tagged marker for the cis-Golgi (FAP optimized for yeast expression)DepositorInsertANP1-FAPoptim
ExpressionYeastPromoterTEF1Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ERG6-FAPoptim
Plasmid#221121PurposeFAP-tagged marker for lipid droplets (FAP optimized for yeast expression)DepositorInsertERG6-FAPoptim
ExpressionYeastPromoterTEF1Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-PMA1-FAPoptim
Plasmid#221122PurposeFAP-tagged marker for the plasma membrane (FAP optimized for yeast expression)DepositorInsertPMA1-FAPoptim
ExpressionYeastPromoterTEF1Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-RPA34-FAPoptim
Plasmid#221123PurposeFAP-tagged marker for the nucleus (FAP optimized for yeast expression)DepositorInsertRPA34-FAPoptim
ExpressionYeastPromoterTEF1Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-SEC7-FAPoptim
Plasmid#221124PurposeFAP-tagged marker for the trans-Golgi (FAP optimized for yeast expression)DepositorInsertSEC7-FAPoptim
ExpressionYeastPromoterTEF1Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-VPH1-FAPoptim
Plasmid#221125PurposeFAP-tagged marker for the vacuolar membrane (FAP optimized for yeast expression)DepositorInsertVPH1-FAPoptim
ExpressionYeastPromoterTEF1Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-NFAPoptim
Plasmid#221088PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-CFAPoptim
Plasmid#221089PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-NFAPorig
Plasmid#221091PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only