8,418 results
-
Plasmid#194529PurposeHigh copy vector backbone with G418 selectivity, contains TDH3(pr)-MCS-CYC1(3'UTR)DepositorTypeEmpty backboneExpressionYeastAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pRSII41N-TDH3pr
Plasmid#194530PurposeLow copy vector backbone with nourseothricin selectivity, contains TDH3(pr)-MCS-CYC1(3'UTR)DepositorTypeEmpty backboneExpressionYeastAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41H-TDH3pr
Plasmid#194532PurposeLow copy vector backbone with hygromycin B selectivity, contains TDH3(pr)-MCS-CYC1(3'UTR)DepositorTypeEmpty backboneExpressionYeastAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41K-TDH3pr-mNeon
Plasmid#194534PurposeLow copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42K-TDH3pr-mNeon
Plasmid#194535PurposeHigh copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41N-TDH3pr-mNeon
Plasmid#194536PurposeLow copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N-TDH3pr-mNeon
Plasmid#194537PurposeHigh copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41H-TDH3pr-mNeon
Plasmid#194538PurposeLow copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM038_P8b_5'Lys3
Plasmid#216463Purpose5' homology arm for S. pombe genomic integration. Part type 8b following the YeastToolkit MoClo grammar.DepositorInsert5'lys3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only