We narrowed to 17,735 results for: por
-
Plasmid#221598PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with KRN-3A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC-IRES-Blasti
Plasmid#242462PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_G198R
Plasmid#242465PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199R
Plasmid#242466PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199G
Plasmid#242467PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199G mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_ANK3-4
Plasmid#242468PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The ANK3-4 mutations disrupt XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationANK3-4 = R87A - E95A - K96A - W124G - K128GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-CMV-myc-XPO1_H10-11
Plasmid#242471PurposeExpresses human XPO1 protein with an N-terminal cMyc tag. The H10-11 mutations disrupt ASB8 binding.DepositorInsertXPO1 (XPO1 Human)
TagscMycExpressionMammalianMutationXPO1 H10-11 = E478A - H481A - V484G - N485G - T48…PromoterCMVAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-Tag100-hASB8_G198R
Plasmid#242461PurposeExpresses human ASB8 protein with an N-terminal Tag100 along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTagsTag100ExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC_K7R-IRES-Blasti
Plasmid#242463PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker. The K7R mutations prevent ubiquitin chain elongation.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only