We narrowed to 7,572 results for: aav
-
Plasmid#214568PurposeAiE2464m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1878 - pAAV-AiE2425m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214566PurposeAiE2425m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1690 - pAAV-AiE2365m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214517PurposeAiE2365m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1844 - pAAV-AiE2474m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214549PurposeAiE2474m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1970 - pAAV-AiE2585m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214598PurposeAiE2585m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1895 - pAAV-AiE2583m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214574PurposeAiE2583m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1897 - pAAV-AiE2486m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214575PurposeAiE2486m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1916 - pAAV-AiE2437m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214577PurposeAiE2437m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1920 - pAAV-AiE2375m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214580PurposeAiE2375m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1923 - pAAV-AiE2455m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214582PurposeAiE2455m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1933 - pAAV-AiE2446m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214585PurposeAiE2446m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1939 - pAAV-AiE2522m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214586PurposeAiE2522m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1941 - pAAV-AiE2525m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214587PurposeAiE2525m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1956 - pAAV-AiE2550m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214589PurposeAiE2550m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1959 - pAAV-AiE2588m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214590PurposeAiE2588m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1963 - pAAV-AiE2592m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214593PurposeAiE2592m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1965 - pAAV-AiE2475m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214595PurposeAiE2475m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1847 - pAAV-AiE2399m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214551PurposeAiE2399m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1851 - pAAV-AiE2530m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214554PurposeAiE2530m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1852 - pAAV-AiE2531m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214555PurposeAiE2531m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1854 - pAAV-AiE2536m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214556PurposeAiE2536m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1856 - pAAV-AiE2431m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214557PurposeAiE2431m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1860 - pAAV-AiE2564m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214559PurposeAiE2564m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1865 - pAAV-AiE2557m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214562PurposeAiE2557m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1869 - pAAV-AiE2443m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214563PurposeAiE2443m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1873 - pAAV-AiE2499m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214564PurposeAiE2499m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1876 - pAAV-AiE2413m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214565PurposeAiE2413m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1879 - pAAV-AiE2570m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214567PurposeAiE2570m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1885 - pAAV-AiE2572m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214569PurposeAiE2572m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1726 - pAAV-AiE2395m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214529PurposeAiE2395m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1729 - pAAV-AiE2400m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214530PurposeAiE2400m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1743 - pAAV-AiE2420m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214534PurposeAiE2420m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1745 - pAAV-AiE2426m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214535PurposeAiE2426m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1746 - pAAV-AiE2428m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214536PurposeAiE2428m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1772 - pAAV-AiE2403m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214539PurposeAiE2403m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1775 - pAAV-AiE2465m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214541PurposeAiE2465m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1782 - pAAV-AiE2502m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214545PurposeAiE2502m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1832 - pAAV-AiE2459m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214547PurposeAiE2459m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1834 - pAAV-AiE2487m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214548PurposeAiE2487m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1846 - pAAV-AiE2555m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214550PurposeAiE2555m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1660 - pAAV-AiE2342m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214510PurposeAiE2342m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1661 - pAAV-AiE2343m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214511PurposeAiE2343m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1663 - pAAV-AiE2346m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214512PurposeAiE2346m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1669 - pAAV-AiE2348m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214514PurposeAiE2348m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1671 - pAAV-AiE2351m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214515PurposeAiE2351m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1680 - pAAV-AiE2362m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214516PurposeAiE2362m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1691 - pAAV-AiE2366m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214518PurposeAiE2366m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1694 - pAAV-AiE2369m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214519PurposeAiE2369m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1698 - pAAV-AiE2373m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214520PurposeAiE2373m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only