We narrowed to 7,692 results for: Lif;
-
Plasmid#65499PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-mCer-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pFLIP32
Plasmid#65500PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-t7CFPt9-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFLIP39
Plasmid#65507PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edAFPt9-attR1 and attR2-t7edCFPt9-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDonr201_PARG WT
Plasmid#240315PurposeEntry vector for Gateway with PARGDepositorInsertPARG (PARG Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJFT7_nHalo_DC(r4)_PARG_Mutation
Plasmid#240316PurposeGateway compatible vector expressing PARG (E755/756A)DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-moxBFP-IRES-PuroR
Plasmid#242413PurposeSpectral unmixing: moxBFP onlyDepositorInsertsmoxBFP
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-PuroR
Plasmid#242415PurposeSpectral unmixing: mScarlet3 onlyDepositorInsertsmScarlet3
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only