We narrowed to 13,211 results for: BASE
-
Plasmid#209931PurposeCre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter. Based on construct from Pouchelon et al Cell Rep Methods. 2022.DepositorInsertGCaMP6f
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-COX8 MTS-3xFlag-TALE array-CBE6d-UGI-P2A-mCherry-UTR
Plasmid#235202PurposePlasmids for constructing mitoBEs v2DepositorInsertCOX8 MTS-3xFlag-TALE array-CBE6d-UGI-P2A-mCherry-UTR
ExpressionMammalianAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP576
Plasmid#85943PurposeTemperature sensitive plasmid based on pDK46. Expresses dCas9 from proD. Serves as a control for pOP587 - pOP594DepositorInsertdCas9
ExpressionBacterialAvailable SinceJuly 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
AdeC-pET21b
Plasmid#218482PurposeExpresses adenine deaminase in E. coli with a C-terminal his tagDepositorInsertAdenine deaminase
TagsHis tagExpressionBacterialAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vector 1174K
Plasmid#221017PurposeFluorescent based sex separator in Anopheles species mosquitoes (SEPARATOR)DepositorInsertEngineered dobulesex splicing module (Anopheles gambiae)
UseSynthetic BiologyExpressionInsectAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only