We narrowed to 3,219 results for: Streptococcus
-
Plasmid#99687PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 17 nt snRP1 poly adenylation signalDepositorPublicationInsertdCas9
UseAAVTagsVPR miniMutationdead Cas9Available sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9
Plasmid#130968Purpose3xHA tagged Cas9 from S. pyogenes with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-SpCas9
UseCRISPRTags3x HA, EGFP, and NLSExpressionMammalianPromoterCbhAvailable sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable sinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-FNLS-T2A-EGFP-ires-puro
Plasmid#121169PurposeCAG promoter driven expression of FNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianAvailable sinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET42b-A3A-PBE-ΔUGI
Plasmid#119771PurposeTo express the recombinant APOBEC3A in vitroDepositorInsertAPOBEC3A-nCas9-NLS
Tags6*HIS and NLSExpressionBacterialMutationnCas9 has a mutation D10A in wild type SpCas9PromoterT7 promoterAvailable sinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJin-264
Plasmid#125717PurposeABA-inducible split T7 gRNA for GFP vector using RNAPN d5-19DepositorInsertPT7-gRNA GFP expression, PYL-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-ABI
ExpressionMammalianAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJin-290
Plasmid#125718PurposeABA-inducible split T7 gRNA for GFP vector using RNAPN d5-19 with CGG RNAP-CDepositorInsertPCGG-gRNA GFP-off expression, FKBP-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-FRB
ExpressionMammalianAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
nCas9-UGI-NLS-P2A-EGFP (pJUL1001)
Plasmid#123611PurposeCAG promoter expression plasmid for hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (BE3 control without rAPOBEC1).DepositorInsertnCas9-UGI-NLS-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CRISPR-Sa-TdTom. Reporter
Plasmid#99652PurposeRed fluorescent reporter that can be activated by dSa Cas9 activator indicating activityDepositorInsertRFP
ExpressionMammalianMutationdead Cas9Available sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2XNLS-SpCas9MT3-NLS-3XHA-2XNLS-NmdCas9-2XNLS
Plasmid#107323PurposeExpresses SpCas9 (R1335K) fused to dNmCas9 in mammalian cellsDepositorInsertSpCas9-NmCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1335K) is fused to nuclease dead NmCas9 …PromoterCMV IE94Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR0SP0013
Plasmid#117521PurposeLevel0 Golden Gate part: CDS, SpCas9-pDepositorInsertSpCas9-p (with stop codon)
UseCRISPRAvailable sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307_ms2_VP64
Plasmid#79375PurposeRecruits VP64 to compatible gRNAs for transcriptional activationDepositorInsertms2-VP64
UseCRISPRExpressionMammalianAvailable sinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFG018
Plasmid#62817PurposeBacterial inducible gRNA expression plasmidDepositorInsertgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPBADAvailable sinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pICSL11057
Plasmid#68253PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_1 in barleyDepositorInsertPromote:TaU6+sgRNA HvPM19_1
UseSynthetic BiologyExpressionPlantAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
Mesp-1916/-1>nls::Cas9::nls
Plasmid#59988PurposeMesp driver driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Mesp -1916/-1Available sinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRS303-pGAL-SPPHO5-G-SrtAstrep-HA-HDEL (pKS82)
Plasmid#50032PurposeGalactose-inducible expression of ER-luminal S. pyogenes SrtA in yeastDepositorInsertHA-SrtA(strep)
TagsHA-HDELExpressionYeastPromoterpGALAvailable sinceJan. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-B
Plasmid#48663PurposeBacterial TD repression YFP reporter: protospacer BDepositorInsertTD prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only