We narrowed to 42,524 results for: cha
-
Plasmid#170282PurposeExpresses both yeast Tim8 and yeast Tim13 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertyeast Tim8 and Tim13 (TIM8 Budding Yeast)
UseTagsTEV-cleavable N-terminal His tag on Tim13 (on bac…ExpressionBacterialMutationPromoterAvailable sinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4_MP
Plasmid#228358PurposeABE8e-SpCas9-NG Multiplex Acceptor clone for insertion of up to six gRNA cassettes via Golden Gate with BpiI and T4 ligase, blue-white screeningDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS2
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionTagsExpressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
Syn-ATP
Plasmid#51819PurposeOptical reporter of presynaptic ATPDepositorInsertChimeric Synaptophysin-mCherry-Luciferase
UseTagsExpressionMammalianMutationWithin WT luciferase gene, changed Threonine 214 …PromoterCMVAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorInserthsTRPA1 (TRPA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only