We narrowed to 42,524 results for: cha
-
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CPH3486 (YCp LEU2 Rpb1 F1492A)
Plasmid#91808PurposeYeast expression of S. cerevisiae Rpb1 with a F1492A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged phenylalanine 1492 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3487 (YCp LEU2 Rpb1 S1493A)
Plasmid#91809PurposeYeast expression of S. cerevisiae Rpb1 with a S1493A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged serine 1493 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3488 (YCp LEU2 Rpb1 P1494A)
Plasmid#91810PurposeYeast expression of S. cerevisiae Rpb1 with a P1494A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged proline 1494 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3508 (YCp LEU2 Rpb1 Y1473A)
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3509 (YCp LEU2 Rpb1 T1471A)
Plasmid#91812PurposeYeast expression of S. cerevisiae Rpb1 with a T1471A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged threonine 1471 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3511 (YCp LEU2 Rpb1 P1472A)
Plasmid#91813PurposeYeast expression of S. cerevisiae Rpb1 with a P1472A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged proline 1472 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3567 (pET151_Spt6 1247-1451 R1282H)
Plasmid#91816PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with an R1282H mutationDepositorInsertSPT6 (SPT6 Budding Yeast)
UseTags6xHisExpressionBacterialMutationchanged arginine 1282 to histidine; deleted resid…PromoterT7Available sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3495 (pET151_Spt6 1247-1451 K1435A)
Plasmid#91817PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with a K1435A mutationDepositorInsertSPT6 (SPT6 Budding Yeast)
UseTags6xHisExpressionBacterialMutationchanged lysine 1435 to alanine; deleted residues …PromoterT7Available sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP110 [pRS416-YBR139Wp-YBR139W(N163,242Q)-PA-ADH1t]
Plasmid#106462PurposeExpresses Atg42/Ybr139w(N163,242Q) with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W(N163,242Q)
UseTagsPAExpressionBacterial and YeastMutationchanged Asparagines at positions 163 and 242 to G…PromoterYBR139WAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only