We narrowed to 9,048 results for: sgRNA
-
Plasmid#154331PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1849
Plasmid#154327PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
BC1441-mouse U6-3xsgRNAs (TS5, TS6, TS7)
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorInsertsgTS5-sgTS6-sgTS7
UseCRISPRPromotermouse U6Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti ccdB Dang sgRNA Hyg sfGFP
Plasmid#235047PurposeLentiviral sgRNA expression with optimized sgRNA scaffold vector with hygromycin and superfolder GFP. Also contains ccdB cassette for library cloning.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-XRN2_sgRNA_2
Plasmid#242896PurposePiggyBac cargo vector with XRN2 sgRNA 2 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_5
Plasmid#242900PurposePiggyBac cargo vector with HNRNPU sgRNA 5 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_1
Plasmid#242901PurposePiggyBac cargo vector with HNRNPU sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_3
Plasmid#242902PurposePiggyBac cargo vector with HNRNPU sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPL_sgRNA_3
Plasmid#242892PurposePiggyBac cargo vector with HNRNPL sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-YTHDC1_sgRNA_4
Plasmid#242893PurposePiggyBac cargo vector with YTHDC1 sgRNA 4 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-YTHDC1_sgRNA_2a
Plasmid#242894PurposePiggyBac cargo vector with YTHDC1 sgRNA 2a for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196988PurposeDerived from pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, custom sgRNA cloning vectorDepositorInsertNestin-dCas9-KRAB-T2a-GFP
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHB
Plasmid#177981Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHBDepositorInsertsgRNA targeting SDHB (SDHB Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFH113
Plasmid#128210Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only