We narrowed to 10,649 results for: sgRNA
-
Viral Prep#73179-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiCRISPRv2 (#73179). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2 plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2.DepositorAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only
-
Human sgRNA library Brunello in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73178-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiGuide-Puro (#73178). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiGuide-Puro plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Use on cells that are stably expressing Cas9 to make edits across 19,114 genes in the human genome.DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human CRISPRi sgRNA library Dolcetto in backbone XPR_050, Set A (Lentiviral Prep)
Viral Prep#92385-LVPurposeReady-to-use Lentiviral Prep particles produced from Human CRISPRi sgRNA library Dolcetto in backbone XPR_050, Set A (#92385). In addition to the viral particles, you will also receive purified Human CRISPRi sgRNA library Dolcetto in backbone XPR_050, Set A plasmid DNA.DepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (Lentiviral Prep)
Viral Prep#92379-LVPurposeReady-to-use Lentiviral Prep particles produced from Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (#92379). In addition to the viral particles, you will also receive purified Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR activation screening in human cells. Contains 56,762 sgRNAs, targeting 18,885 genes. Concentrated lentiviral particles carrying set A of the Calabrese human CRISPRa sgRNA activation library in backbone XPR_502 (P65 HSF) .DepositorAvailable SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2
Plasmid#74009PurposeTissue-specific knock-out in zebrafish, Cas9 and GFP driven by a UAS promoterDepositorInserts5x UAS
Cas9
T2A
GFP
U6 promoter
UseCRISPRAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2
Plasmid#74010PurposeTissue-specific knock-out in zebrafish, Cas9 and Cre driven by a UAS promoterDepositorInserts5xUAS
Cas9
Cre
U6 promoter
UseCRISPRAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR (AAV-KPL)
Plasmid#60224PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and three U6-driven sgRNAs targeting Kras, p53, and Lkb1. Contains KrasG12D HDR donor. AAV backbone.DepositorInsertsUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS, No promoter, and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA
Plasmid#71409PurposeThere is no gene/insert. It is a backbone plasmid that others can use to insert sgRNAs of interest. The cloning site for this BsmBIDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA
Plasmid#50662PurposeLentiviral expression of AAVS1-targeting sgRNA; insert can be replaced with custom sgRNA (see protocol)DepositorInsertsgAAVS1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1
Plasmid#49772PurposeLevel 2 constructDepositorInsertsgRNA_PDS2-Cas9-sgRNA_PDS1
UseCRISPRExpressionPlantAvailable SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
U6>sgRNA(F+E)
Plasmid#59986PurposeEmpty vector for sgRNA cloning (F+E modified backbone)DepositorTypeEmpty backboneUseCRISPRPromoterCiinte.U6Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_Luciferase_sgRNA
Plasmid#74190Purposelentiviral vector expressing sgRNA targeting LuciferaseDepositorInsertLuciferase sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available SinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only