Cas9-sgRNA-A
(Plasmid
#149369)
-
PurposeExpresses SpCas9 and sgRNA targeting the lenti-CDDR reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149369 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
Alt nameS. pyogenes Cas9
-
Insert Size (bp)4507
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- SV40 NLS (N terminal on insert)
- Nucleoplasmin NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA-A
-
Insert Size (bp)102
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer hU6-F (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePuromycin resistance
-
Alt namePuroR
-
Insert Size (bp)600
- Promoter PGK
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer cattctgcacgcttcaaaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9-sgRNA-A was a gift from Tarek Abbas (Addgene plasmid # 149369 ; http://n2t.net/addgene:149369 ; RRID:Addgene_149369) -
For your References section:
A robust CRISPR-Cas9-based fluorescent reporter assay for the detection and quantification of DNA double-strand break repair. Eki R, She J, Parlak M, Benamar M, Du KP, Kumar P, Abbas T. Nucleic Acids Res. 2020 Oct 17. pii: 5929239. doi: 10.1093/nar/gkaa897. 10.1093/nar/gkaa897 PubMed 33068408