Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cas9-sgRNA-A
(Plasmid #149369)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149369 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Alt name
    S. pyogenes Cas9
  • Insert Size (bp)
    4507
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • SV40 NLS (N terminal on insert)
    • Nucleoplasmin NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA-A
  • Insert Size (bp)
    102
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer hU6-F
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Puromycin resistance
  • Alt name
    PuroR
  • Insert Size (bp)
    600
  • Promoter PGK

Cloning Information for Gene/Insert 3

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cas9-sgRNA-A was a gift from Tarek Abbas (Addgene plasmid # 149369 ; http://n2t.net/addgene:149369 ; RRID:Addgene_149369)
  • For your References section:

    A robust CRISPR-Cas9-based fluorescent reporter assay for the detection and quantification of DNA double-strand break repair. Eki R, She J, Parlak M, Benamar M, Du KP, Kumar P, Abbas T. Nucleic Acids Res. 2020 Oct 17. pii: 5929239. doi: 10.1093/nar/gkaa897. 10.1093/nar/gkaa897 PubMed 33068408