We narrowed to 6,508 results for: human c myc
-
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorInsertAMBRA (AMBRA1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#2
Plasmid#174147PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorInsertAMBRA (AMBRA1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#1
Plasmid#174146PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorInsertAMBRA (AMBRA1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACTA2_HL-P2A-eGFP-PGK-PuroR-ACTA2_HR
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertGFP
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKWT
Plasmid#216540PurposeThis retroviral plasmid expresses the human wild type PTK2DepositorInsertPTK2 (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationwild type sequencePromoterAvailable sinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-mCh
Plasmid#108854PurposeEncodes for human VEGFR2 fluorescently labeled with mCherry on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorInsertKDR (KDR Human)
UseTagsLabeled with mCherry on the C-Terminus via a 3 am…ExpressionMammalianMutationPromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9
Plasmid#49330PurposeExpresses sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertsCas9
dU6-sgRNA
UseCRISPRTags3xFLAG and NLSExpressionInsectMutationHuman codon optimisedPromoterActin-5c and Drosophila U6Available sinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-YFP
Plasmid#108853PurposeEncodes for human VEGFR2 fluorescently labeled with eYFP on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorInsertKDR (KDR Human)
UseTagsLabeled with eYFP on the C-Terminus via a 3 amino…ExpressionMammalianMutationPromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 1-120
Plasmid#112706PurposeExpresses N-terminally FLAG-tagged human RNMT 1-120 in mammalian cellsDepositorInsertRNMT (RNMT Human)
UseTagsFLAGExpressionMammalianMutationdeleted amino acids 121-476PromoterCMVAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 121-476
Plasmid#112707PurposeExpresses N-terminally FLAG-tagged human RNMT 121-476 in mammalian cellsDepositorInsertRNMT (RNMT Human)
UseTagsFLAGExpressionMammalianMutationdeleted amino acids 2-120PromoterCMVAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyTagsExpressionBacterial and YeastMutationPromoter2xLexop-minimalCyc1 and PACT1Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorInsertRAF1 (RAF1 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSF-DUET-C17orf53_1-87-Strep
Plasmid#211433Purposebacterial expression of the N-terminal amino acids 1-87 of human C17orf53 C-terminally fused to a Strep-TagDepositorInsertC17orf53 (HROB Human)
UseTagsStrep-TagExpressionBacterialMutationDeletion of aa 88-646PromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-PKMYT1-V5_IDG-K
Plasmid#135248PurposeGateway destination clone of PKMYT1 (human) tagged with C-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertPKMYT1-V5 (PKMYT1 Human)
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianMutationPromoterUbiquitinAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E006 Hs.AKT3-nostop
Plasmid#70290PurposeGateway ORF clone of human AKT3 [NM_005465.4] without stop codon (for C-terminal fusions)DepositorInsertAKT 3 (AKT3 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSF-DUET-C17orf53_1-241-Strep
Plasmid#211434Purposebacterial expression of the N-terminal amino acids 1-241 of human C17orf53 C-terminally fused to a Strep-TagDepositorInsertC17orf53 (HROB Human)
UseTagsStrep-TagExpressionBacterialMutationDeletion of aa 242-646PromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
R777-E126 Hs.MAPK1-nostop
Plasmid#70410PurposeGateway ORF clone of human MAPK1 [NM_002745.4] without stop codon (for C-terminal fusions)DepositorInsertMAPK1 (MAPK1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA6
Plasmid#101418PurposeDonor Vector containing GATA6 transcription factor, part of the Human TFome CollectionDepositorInsertGATA6 (GATA6 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA4
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXN1
Plasmid#101445PurposeDonor Vector containing FOXN1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXN1 (FOXN1 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only