We narrowed to 15,273 results for: grn
-
Plasmid#248534PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA9-3
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA19-3
Plasmid#248547PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA19-3
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX330-sgRNA006_CTCF
Plasmid#232928PurposeExpression vector for a sgRNA against the mouse CTCF locus and SpCas9.DepositorPublicationAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA048_Grb10
Plasmid#232934PurposeExpression vector for a sgRNA against the mouse Grb10 locus and SpCas9 with T2A-Puromycin resistance gene.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-T2A-PuroR (Grb10 S. pyogenes)
ExpressionMammalianAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
EHMT1_exon 3_gRNA
Plasmid#228809PurposeCRISPR targeting of human EHMT1DepositorAvailable sinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti-gRNA
Plasmid#226867PurposeLentiviral expression of Sp-gRNA with BlpI and BstXI restriction sites for gRNA spacer cloning. Also expresses BFP.DepositorInsertLenti Sp-gRNA
UseLentiviralPromotermU6Available sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-R-gfp
Plasmid#220927PurposeExpresses gfp using J23119 promoter and pgRNA_AT backboneDepositorInsertsuperfolder GFP
TagsFLAGExpressionBacterialPromoterJ23119Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNAs-Crym
Plasmid#200067PurposeFor the knock down of Crym with an astrocyte specific mCherry expressionDepositorInsertU6-3xsgRNA-Crym
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSt1Cas9 CNRZ1066 v2 targeting ATM (ATM Human)
UseCRISPRExpressionMammalianPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TKT_sgRNA2
Plasmid#201625PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTKT (TKT Human)
UseCRISPR and LentiviralAvailable sinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TKT_sgRNA1
Plasmid#201624PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTKT (TKT Human)
UseCRISPR and LentiviralAvailable sinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-HK2_sgRNA1
Plasmid#201596PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHK2 (HK2 Human)
UseCRISPR and LentiviralAvailable sinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGAM1_sgRNA2
Plasmid#201615PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only