We narrowed to 3,464 results for: biorxiv
-
Plasmid#231011PurposeCVS N2c RVdG genome plasmid. Utilizes MS2 tagging to deliver the MCP:oScarlet:KASH transcript to the outer nuclear membrane. Insert high complexity barcode between SacII RE sites distal to 6xMBS site.DepositorInsertMCP-oScarlet-KASH-6xMBS-SacIIMCS
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-CDKL5(isoform-2)
Plasmid#245901PurposeMammalian expression of CDKL5 isoform2 (1-1030) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-CDKL5(kinase)
Plasmid#245902PurposeMammalian expression of CDKL5 kinase domain (1-311) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLCe EF-C
Plasmid#244968PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (EF hands 1/2- Cterminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-103…PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe PH-C
Plasmid#244967PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (PH domain - C-terminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-836PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Eco2
Plasmid#240681PurposeRSF1010 origin of replication plasmid containing Eco2 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertEco2 RT, Eco2 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Eco1
Plasmid#240705PurposepLAM12 vector backbone containing Eco1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertEco1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET24+ CUL5(1-384)
Plasmid#246504PurposeRecombinant protein expression of CUL5(1-384)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Eco2
Plasmid#240706PurposepLAM12 vector backbone containing Eco2 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertEco2 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Eco1
Plasmid#240691PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010C-Eco1
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only