We narrowed to 3,698 results for: biorxiv
-
Plasmid#240691PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010C-Eco1
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Kva1
Plasmid#240684PurposeRSF1010 origin of replication plasmid containing Kva1 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertKva1 RT,Kva1 ncRNA, Beta and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Eco1
Plasmid#240680PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-K30A
Plasmid#236066PurposeSmBit-CHIP expression with K30A substitutionDepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGADT7_Sr62TK-Kinase1
Plasmid#233529PurposeExpresses Sr62TK-Kinase1 in yeastDepositorInsertSr62TK-Kinase1
TagsGAL4 AD, HA tagExpressionYeastPromoterADH1Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Tsp1
Plasmid#240712PurposepLAM12 vector backbone containing Tsp1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertTsp11 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Kva1
Plasmid#240709PurposepLAM12 vector backbone containing Kva1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertKva1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Hcl1
Plasmid#240714PurposepLAM12 vector backbone containing Hcl1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertHcl1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Eas1
Plasmid#240710PurposepLAM12 vector backbone containing Eas1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertEas1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only