We narrowed to 173,766 results for: Gene
-
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCDNA-TAZ-CAMTA1
Plasmid#235679PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-35S
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrActin-UBI
Plasmid#226709PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrActin promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrActin
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA8
Plasmid#196103PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196106, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA19-HSPB1 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#199450PurposeCRISPR donor plasmid to insert TriTag (mTagBFP harbors 12XMS2 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA20-HSPB1 5'HA-mTagBFP-3'-UTR 12XMS2V5-3'HA (HDR donor)
Plasmid#199451PurposeCRISPR donor plasmid to insert [mTagBFP-stop-12XMS2] into the C-terminus of human HSPB1 gene; 12XMS2 locates in the 3' UTR regionDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA21-HSPB1 5'HA-NarTag (12XPP7)-3'HA (HDR donor)
Plasmid#199452PurposeCRISPR donor plasmid to insert NarTag (mTagBFP harbors 12XPP7 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only