We narrowed to 3,621 results for: biorxiv
-
Plasmid#242774PurposeAAV transfer plasmid expressing eGFP-ProteinC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsProteinCPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-Tag100
Plasmid#242779PurposeAAV transfer plasmid expressing eGFP-Tag100 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsTag100PromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-SPOT
Plasmid#242777PurposeAAV transfer plasmid expressing eGFP-SPOT under a CAG promoter.DepositorInsertEGFP
UseAAVTagsSPOTPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-AU5
Plasmid#242765PurposeAAV transfer plasmid expressing eGFP-AU5 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsAU5PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-E2
Plasmid#242766PurposeAAV transfer plasmid expressing eGFP-E2 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsE2PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ETAG
Plasmid#242767PurposeAAV transfer plasmid expressing eGFP-ETAG under a CAG promoter.DepositorInsertEGFP
UseAAVTagsETAGPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-MoonTag
Plasmid#242770PurposeAAV transfer plasmid expressing eGFP-MoonTag under a CAG promoter.DepositorInsertEGFP
UseAAVTagsMoonTagPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-MYC
Plasmid#242771PurposeAAV transfer plasmid expressing eGFP-MYC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsMYCPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-NWS
Plasmid#242772PurposeAAV transfer plasmid expressing eGFP-NWS under a CAG promoter.DepositorInsertEGFP
UseAAVTagsNWSPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-OLLAS
Plasmid#242773PurposeAAV transfer plasmid expressing eGFP-OLLAS under a CAG promoter.DepositorInsertEGFP
UseAAVTagsOLLASPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-S1
Plasmid#242775PurposeAAV transfer plasmid expressing eGFP-S1 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsS1PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-SunTag
Plasmid#242776PurposeAAV transfer plasmid expressing eGFP-SunTag under a CAG promoter.DepositorInsertEGFP
UseAAVTagsSunTagPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-TY1
Plasmid#242780PurposeAAV transfer plasmid expressing eGFP-TY1 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsTY1PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225701PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mTurquoise fused BlasticidinRDepositorUseLentiviralTags3xAID HA and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC3.1_CMV_oROS-G_LF(C199S)
Plasmid#216112PurposeExpresses the loss-of-function mutations C199S of the genetically encoded green fluorescent hydrogen peroxide sensor oROS-G in mamalian cells.DepositorInsertoROS-G_LF(C199S)
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GNT5-blast
Plasmid#208380Purposelentiviral vector for expressing human B3GNT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertBeta-1,3-N-Acetylglucosaminyltransferase 5 (B3GNT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnt 922 c->g (PAM site inactivation)PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only