We narrowed to 7,550 results for: aav
-
Plasmid#223157PurposeExpression of KRAB with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB
UseAAV and CRISPRTags3xFLAGExpressionMammalianPromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-IvfChr-citrine-KV2.1
Plasmid#221615PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement and soma targeting with KV2.1 motif.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement and soma targeting
UseAAVMutationvfChrimson-citrine with membrane trafficking enha…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-mScarlet-KV2.1
Plasmid#221617PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151T)-mScarlet with soma targeting
UseAAVMutationZipACR (I151T) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-mScarlet-KV2.1
Plasmid#221616PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151V)-mScarlet with soma targeting
UseAAVMutationZipACR (I151V) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(D387A eGFP)
Plasmid#221603PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, eGFP)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV2 AAV-RapaInducible-NFZ-HGF
Plasmid#188749PurposeRapamycin inducible AAV vector expressing HGFDepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT314 AAV-Rapamycin Inducible-NZ-Citrine
Plasmid#202063PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible-NZ-Citrine
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT365 AAV-Rapamycin Inducible-S3H
Plasmid#202066PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible-S3H
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT366 AAV-Rapamycin Inducible QNZF
Plasmid#202067PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible QNZF
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT313 AAV-Rapamycin Inducible-ZF-Citrine
Plasmid#202062PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible-ZF-Citrine
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-K-red-SPOTIT(R271F)
Plasmid#191494PurposeRed fluorescent-based opioid sensor for the kappa opioid receptor with reduced Gai coupling in AAV viral vector under a CAG promoterDepositorInsertK-red-SPOTIT(R271F)
UseAAVMutationR271F in ORPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-M-red-SPOTIT2(R279F)
Plasmid#191495PurposeRed fluorescent-based opioid sensor for the mu opioid receptor with reduced Gai coupling in AAV viral vector under a CAG promoterDepositorInsertM-red-SPOTIT2(R279F)
UseAAVMutationR279F in ORPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_g5-HT2h
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BR1-P2A-FusionRed
Plasmid#192819PurposeExpresses BR1 with FusionRed tag in mammalian cellsDepositorInsertBR1 (BRI1 Mustard Weed)
UseAAVTagsFusionRedExpressionMammalianPromoterchicken β-actin promoterAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-Best1-nt.Txnip(C247S)(1-320aa)
Plasmid#206352PurposeAAV plasmid expressing deltion and mutant TXNIP in retinal pigment epitheliumDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only