We narrowed to 24,482 results for: c-myc
-
Plasmid#31138DepositorInsertADAM7 (ADAM7 Human)
TagsFLAGExpressionMammalianMutationHistidine 243 changed to TyrosineAvailable SinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mTDGa-BioID2-HA
Plasmid#232027Purposemammalian expression (CMV promoter) of murine TDG fused to BioID2-HADepositorAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V2
Plasmid#226955PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7578 pHR (hU6-crPROX-EFS-PuroR-WPRE)
Plasmid#214882PurposeLentiviral vector encoding RfxCas13d targeting PROX guide arrayDepositorInserthU6-crPROX-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-His6-CUbo(K48R)-GFP
Plasmid#212793PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K48R)-GFP in budding yeastDepositorInsertHis6-CUbo(K48R)-GFP
UseIntegrative vectorExpressionYeastMutationCUb(K48R)PromoterCUP1Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-His6-CUbo(K63R)-GFP
Plasmid#212794PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K63R)-GFP in budding yeastDepositorInsertHis6-CUbo(K63R)-GFP
UseIntegrative vectorExpressionYeastMutationCUb(K63R)PromoterCUP1Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only