We narrowed to 7,455 results for: trac
-
Plasmid#49066PurposeExpresses human NKCC1 C295S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC295S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIG-749_HA-GD2-28z_CAR_TFAP4
Plasmid#207490PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-806_HA-GD2-28z_CAR_RFP-TFAP4
Plasmid#207493PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-851_HA-GD2-28z_HA-TFAP4
Plasmid#207501PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertHA-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-852_HA-GD2-28z_TFAP4-HA
Plasmid#207502PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4-HA, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma10-GFP2
Plasmid#166779PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma10-GFP2 (GNG10 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma5-GFP2
Plasmid#166777PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma5-GFP2 (GNG5 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma4-GFP2
Plasmid#166776PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma4-GFP2 (GNG4 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-hPGK-Blast-2A-STING-mNeonGreen
Plasmid#227186PurposeLentiviral expression plasmid encoding STING-mNeonGreen under hPGK promoterDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – H2B-GFP-N – loxP – mScarlet
Plasmid#219565Purpose3` circularization cassette to induce Cre-mediated circularization of a genomic region flanked by loxP sites with H2B-GFP reconstitution and mScarlet expression from the chromosomeDepositorInsertHygroR_2A_H2B-GFP-N_loxP_mScarlet
UseUnspecifiedPromoterEF-1aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaQ-RLuc8
Plasmid#140982PurposeEncodes a G alpha subunit (GNAQ) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaQ-RLuc8 (GNAQ Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai1-RLuc8
Plasmid#140973PurposeEncodes a G alpha subunit (GNAl1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai1-RLuc8 (GNAI1 Human)
UseSynthetic BiologyExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha15-RLuc8
Plasmid#140984PurposeEncodes a G alpha subunit (GNA15) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha15-RLuc8 (GNA15 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3
Plasmid#136364PurposeExpresses epitope-tagged human TET3 WT in mammalian cellsDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX2-tTA2-WPRE-bGHpA
Plasmid#65458PurposeCan be used to generate AAV virus that will express the tetracycline transactivator tTA2 from the CAG promoter in a Cre-dependent mannerDepositorInserttTA2
UseAAVPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Beta1
Plasmid#140987PurposeEncodes a Gbeta subunit (GNB1) as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGBeta1 (GNB1 Human)
ExpressionMammalianMutationContains an N-terminal human rhinovirus (HRV) 3C …PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaGustducin-RLuc8
Plasmid#140979PurposeEncodes a G alpha subunit (GNAT3) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaGustducin-RLuc8 (GNAT3 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-IDH1-R132H-FLAG
Plasmid#66803PurposeTet-inducible expression of mutant IDH1 in mammalian cells, 3rd generation lentiviral vectorDepositorInsertIDH1 (IDH1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationR132HPromoterCMVAvailable SinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only