We narrowed to 6,906 results for: crispr cas9 plasmids
-
Plasmid#112405PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF354BDepositorInsertZNF354B (ZNF354B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF75A.1.0-gDNA
Plasmid#112403PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF75ADepositorInsertZNF75A (ZNF75A Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En01
Plasmid#71534PurposeUsed to construct a gRNA expression cassette for CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationPromoterT7Available sinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only