We narrowed to 27,111 results for: CAT
-
Plasmid#238104PurposeExpresses ME-ABE ABE7.10-HK with SpCas9 (NGDepositorInsertTadA*7.10(Y123H/N157K)-m_SpnCas9(D10A)
UseCRISPRTagsSV40 bpNLS and SV40 bpNLS-P2A-mCherryExpressionMammalianMutationTadA modifications include Y123H, N157K; NG-nCas9…Available SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGE-TET1cd
Plasmid#246818PurposeA GreenGate entry vector containing coding region of the human demethylase TEN-ELEVEN TRANSLOCATION1 catalytic domainDepositorInsertTET1cd (TET1 Human)
UseGreengate cloning entry vectorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ITGAM POD-nAb-WPRE
Plasmid#244975PurposeExpresses a fusion protein of a nanobody against integrin alpha M (ITGAM; CD11b) and peroxidase (POD) in mammalian cellsDepositorInsertITGAM POD-nAb
Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJP_Bla01
Plasmid#230982PurposeModified version of the pBLADE_ONLY_C (#168050). It expresses VVD-AraC, but the f1 ori was deleted and the chloramphenicol resistance gene was replaced by gentamicin resistance.DepositorInsertGentamicin resistance gene
ExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJP_1node
Plasmid#230984PurposepBAD promoter controls the expression of sfGFP. In the presence of VVD-AraC, blue light and L-arabinose can be used to activate mCitrine expression.DepositorInsertmCitrine
ExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RMP64-FLAG (pAVA3889)
Plasmid#239232PurposeExpresses C-FLAG tagged Rmp64 (CMV-RMP64-FLAG)DepositorInsertRMP64-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RMP24-FLAG (pAVA3890)
Plasmid#239234PurposeExpresses C-FLAG tagged Rmp24 (CMV-RMP24-FLAG)DepositorInsertRMP24-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RPP21-FLAG (pAVA3892)
Plasmid#239235PurposeExpresses C-FLAG tagged Rpp21 (CMV-RPP21-FLAG)DepositorInsertRPP21-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RPP25-FLAG (pAVA3895)
Plasmid#239236PurposeExpresses C-FLAG tagged Rpp25 (CMV-RPP25-FLAG)DepositorInsertRPP25-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ntom-Venus-ssrA
Plasmid#223688PurposePhoBIT1 component; Venus-tagged ssrA tag fused with Ntom for mitochondrial tetheringDepositorInsertssrA peptide
TagsmVenusExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCh-sspB(LOV2)
Plasmid#223689PurposePhoBIT1 component; mCherry-tagged sspB with LOV2 insertionDepositorInsertsspB(N)-LOV2-sspB(C)
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-FKP-ET64
Plasmid#234665PurposeExpression an ELP-tagged FKP enzymeDepositorInsertfucokinase/GDP-fucose pyrophosphorylase
TagsELPExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-21_MBP-VidN
Plasmid#241013PurposeVidN construct that can be bacterially expressed, used to demonstrate intein splicing reaction.DepositorInsertMBP-VidN
TagsMBP-tagExpressionBacterialPromoterT7Available SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
P-Bf-fusA2
Plasmid#235658PurposeReports Cur activity in Bacteroides fragilisDepositorInsertBacteroides fragilis fusA2 promoter
MutationThe B. thetaiotaomicron fusA2 promoter lacking &q…Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK401
Plasmid#235482PurposeRepression of gene VIII by Plux/tet hybrid promoterDepositorInsertphage M13 geneVIII, cI repressor
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK201
Plasmid#235481PurposeRepression of gene VIII by Ptac promoterDepositorInsertphage M13 geneVIII, cI repressor
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK328
Plasmid#235479PurposeInducible gene VIII by Pbad/lac hybrid promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK318
Plasmid#235478PurposeInducible gene VIII by Plux/tet hybrid promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK009
Plasmid#235459PurposeNOR gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOR gate
UseSynthetic BiologyAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-393)
Plasmid#236270PurposeBacterial expression of bovine arrestin-2 long isoform (1-393) Q394StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-382)
Plasmid#236269PurposeBacterial expression of bovine arrestin-2 long isoform (1-382) D383StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.4
Plasmid#235455PurposeBUF/YES gate receiver with bs for sgRNA2DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.5
Plasmid#235456PurposeBUF/YES gate receiver with bs for sgRNA3DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK507
Plasmid#235457PurposeOR/NAND gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertOR gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO361
Plasmid#235748PurposeProtein expression of ScVPS34 HELCATDepositorInsertVPS34 HELCAT
ExpressionYeastMutationaa 268-875Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 short
Plasmid#236267PurposeBacterial expression of bovine arrestin-2 short isoformDepositorAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-C-term K-R
Plasmid#233092PurposeExpression of GST-YihI with C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationC-term lysines (K) mutated to arginine (R)Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-S1BD
Plasmid#232580PurposeExpression of the Rnr S1 and basic domains (residues 1930 to 2442) as a GST-fusion.DepositorInsertRnr S1 + basic domain (residues 1930 to 2442)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-ND
Plasmid#232579PurposeExpression of the Rnr nuclease domain (residues 649 to 1929) as a GST-fusion.DepositorInsertRnr nuclease domain (residues 649 to 1929)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-CSD
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHK326
Plasmid#235475PurposeInducible gene VIII by Ptac promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK346
Plasmid#235477PurposeInducible gene VIII by Pbad promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK336
Plasmid#235476PurposeInducible gene VIII by Plux promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK-cinI
Plasmid#235486PurposeInducible gene cinI for OC14-HSL production by Ptac promoterDepositorInsertcinI
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3QS
Plasmid#235485Purposeinducible NOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only