We narrowed to 28,415 results for: cmv promoter
-
Plasmid#92399PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), MCS and IRES controlled Histone2B-EGFP reporter.DepositorInsertIRES H2B EGFP
ExpressionMammalianPromoterCAGAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-UDP1.0-IRES-mCherry-CAAX
Plasmid#220850PurposeCMV promoter drives the expression of an extracellular UDP sensor (UDP1.0) and a membrane localized mCherryDepositorInsertUDP1.0
ExpressionMammalianPromoterCMVAvailable sinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A)
Plasmid#61364Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutations H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; H1415A/E1423A/Y14…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRF.1 udsVenus (P_JUND)
Plasmid#58692PurposeA rapidly responsive reporter of endogenous JUND promoter activity (Lentiviral expression vector for reporter ultradestabilized Venus)DepositorAvailable sinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EW499 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(N2093W, T2098L)
Plasmid#236146PurposePlasmid encoding the NZF transcriptional activation domain attached by a deimmunized linker to FRB with N2093W and T098L mutations, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
ExpressionMammalianMutationN2093W, T2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSM32.2
Plasmid#101635PurposeEncodes the fluorescent protein Rosmarinus under a CMV promoter.DepositorInsertRosmarinus
ExpressionMammalianPromoterCMVAvailable sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-CMV-mCherry-WPRE
Plasmid#250406PurposeLentiviral expression of mCherry under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertmCherry
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianPromoterCMVAvailable sinceJuly 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EW489 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-(GGS)x8[G2V G4W S6L G7L G10W G11D G13L G17M G19I G22M G23Q S24Q]-FKBP (FLP-IN)
Plasmid#236147PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to FKBP1A, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-FKBP
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4
Plasmid#253816Purposeempty backbone featuring CMV promoter.DepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable sinceJune 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-NNG-Slug-nCas9(D10A)-PolI5MΔ
Plasmid#249079PurposeExpresses nucleus-localized NNG-Slug-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertNNG-Slug-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
CABE-T1.17
Plasmid#193260PurposeExpression of CABE-T1.17 base editor in mammalian cells, CMV promoterDepositorInsertCABE-T1.17
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable sinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CABE-T2.9
Plasmid#193264PurposeExpression of CABE-T2.9 base editor in mammalian cells, CMV promoterDepositorInsertCABE-T2.9
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable sinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-VRQR (pBM1173)
Plasmid#140255PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInsertBE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eVRQR-P2A-EGFP (KAC1028)
Plasmid#242663PurposeCMV promoter expression plasmid for human codon optimized SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFPDepositorInsertpCMV-SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFP
UseCRISPRTagsBPNLSExpressionMammalianMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterCMV and T7Available sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPD1029 ZF43x6-Compact(CMVMin)_EYFP
Plasmid#138913PurposeEYFP reporter vector for the ZF43x6-Compact(overlapping ZF37) promoter with a CMV minimal promoterDepositorInsertZF43x6-Compact(CMVmin)
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-Compact(CMVmin)Available sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
AcrIIA5-E76-LOV-C450A-K488N(M478)
Plasmid#250778PurposeExpresses AcrIIA5-E76-AsLOV2 with C450A and K488N mutation from a CMV promoter. For use in mammalian cellsDepositorInsertAcrIIA5 with an AsLOV2 insertion behind E76 and C450A and K488N mutation
UseCRISPRExpressionMammalianMutationC450A, K488NAvailable sinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHCFnc/V5
Plasmid#247003PurposeExpresses non cleavable HCF-1 with carboxy terminal V5 tag under control of the CMV promoterDepositorInsertHCF-1 (HCFC1 Human)
TagsV5 tagExpressionMammalianMutationGlu to Ala change at amino acid positions 1019,10…Available sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only