We narrowed to 5,296 results for: mag
-
Plasmid#57849PurposeLocalization: Focal Contacts, Excitation: 548, Emission: 561DepositorInsertPaxillin
TagsmKOExpressionMammalianPromoterCMVAvailable sinceOct. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
TOMM70-FKBP12-Halo donor plasmid
Plasmid#239867Purposeendogenously tags TOMM70 with Halo tagDepositorAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-opEas1
Plasmid#240701PurposeRSF1010 origin of replication plasmid containing Eas1 recombitron with extended a1 a2 regions in the ncRNA targeting lacZ locus in Klebsiella pneumoniae ATCC 10031 expressed by Pm promoterDepositorInsertEas1 RT, Eas1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable sinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn:FLEX-Soma-jGCaMP8s
Plasmid#239669PurposeCre-dependent expression of Soma-jGCaMP8s under hSyn promoter.DepositorInsertSoma-jGCaMP8s
UseAAVTags6xHis and EE-RRExpressionMammalianPromoterhSynAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn:FLEX-Soma-jGCaMP8f
Plasmid#239671PurposeCre-dependent expression of Soma-jGCaMP8f under hSyn promoter.DepositorInsertSoma-jGCaMP8f
UseAAVTags6xHis and EE-RRExpressionMammalianPromoterhSynAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-36XMYC array
Plasmid#236380PurposeExpression of array of 36 crRNAs targeting MYCDepositorInsert36xMYC crRNA array (MYC Human)
UseCRISPR and LentiviralAvailable sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-MCP-3XBFP-2xNLS
Plasmid#236371PurposeOverexpression of MCP-3XBFP-2xNLS in human cellsDepositorInsertMCP-3XBFP-2xnls
UseLentiviralAvailable sinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIV3HN-05 LC
Plasmid#236190PurposeProduces the light chain of the human monoclonal antibody PIV3HN-05DepositorInsertPIV3HN-05 light chain
UseAffinity Reagent/ AntibodyExpressionMammalianAvailable sinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_TELO2_dTAG
Plasmid#224380PurposeGenerates TELO2 dTAG N terminal knock-in cell linesDepositorAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-tdMCP-6xGCN4
Plasmid#205159Purposeexpress tdMCP-6xGCN4DepositorInserttdMCP-6xGCN4
ExpressionBacterial and MammalianPromoterCMVAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
GW1-mCherryEA
Plasmid#207867PurposeMammalian expression (cytosol) of the mCherry(I158E/Q160A) mutant as a red fluorescent pH sensorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherryEA
ExpressionMammalianPromoterCMVAvailable sinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
IRE-TPI-wildtype-TREAT
Plasmid#196923PurposeThe coding sequence of Triose phosphate isomerase gene was fused downstream Renilla in the ORFDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRenilla luciferase
ExpressionBacterial and MammalianAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
IRE-miR21-SunTag-TREAT
Plasmid#196932PurposeSunTag cassette was added in the coding region in the miR21-IRE-TREAT reporter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRenilla luciferase
ExpressionBacterial and MammalianAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-2x
Plasmid#172282PurposeExpressing EGFP mRNA fused with 2 tandem repeats of a 50-base sequenceDepositorInsertEGFP-N1-2x
ExpressionMammalianPromoterCMVAvailable sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-4x
Plasmid#172283PurposeExpressing EGFP mRNA fused with 4 tandem repeats of a 50-base sequenceDepositorInsertEGFP-N1-4x
ExpressionMammalianPromoterCMVAvailable sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP3
Plasmid#129506PurposeExpresses AvicFP3 constitutively in E. coli (most strains)DepositorInsertAvicFP3
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT2MP.EF-Q2m
Plasmid#129310PurposeQUEEN ATP sensor for 25degC, Tol2 transposonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertQUEEN-2m
ExpressionMammalianAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
68Q-ymsfGFP
Plasmid#128560PurposeHttex1 (without proline-rich region) fused to ymsfGFPDepositorInsert68Q-Httex1 (without proline-rich region) fused to ymsfGFP
TagsymsfGFPExpressionYeastPromoterGAL1Available sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only