We narrowed to 5,296 results for: mag
-
Plasmid#175775PurposeLentiviral vector expressing N-terminally tagged eGFP-TAX1BP1 CC2DDepositorAvailable sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pHAGE-eGFP-TAX1BP1 CC1D
Plasmid#175774PurposeLentiviral vector expressing N-terminally tagged eGFP-TAX1BP1 CC1DDepositorAvailable sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG500-FKBP-N-frFAST
Plasmid#160060PurposeExpresses FKBP-N-frFAST in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP-N-frFAST
ExpressionMammalianAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
alpha-actinin-mGarnet
Plasmid#104315Purposecodes for a fusion of fluorescent protein mGarnet and human alpha-actin, visualizes human alpha-actininDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertalpha-actinin-mGarnet
ExpressionMammalianPromoterCMVAvailable sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pONL-N1_PTS2
Plasmid#65677PurposeExpresses PTS2-ONL in mammalian cellsDepositorInsertperoxisomal targeting signal 2
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
mKO-Tubulin-6
Plasmid#57850PurposeLocalization: Microtubules, Excitation: 548, Emission: 561DepositorAvailable sinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-HA-Ub-K48
Plasmid#187590PurposeHA tagged ubiquitin with all the Ks mutated into R except K48.DepositorInsertUbiquitin
TagsGSTExpressionBacterialMutationK6R/K11R/K27R/K29R/K63RPromoterTacAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-HA-Ub-KO
Plasmid#187591PurposeHA tagged ubiquitin with all the Ks mutated into R.DepositorInsertUbiquitin
TagsGSTExpressionBacterialMutationK6R/K11R/K27R/K29R/K48R/K63RPromoterTacAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLD1112 TRE-mCherry-SKL-22Xm6A MS2
Plasmid#235128PurposemCherry reporter plasmid for live cell visualization of RNA m6A modificationDepositorInsertTRE-mCherry-SKL-22Xm6A MS2
UseLentiviralExpressionMammalianAvailable sinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmNeonGreenCm
Plasmid#206814PurposeTemplate for hlpA-mneongreen amplification associated with chloramphenicol resistance geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthlpA
UseSynthetic BiologyTagsmNeonGreenMutation3insGAvailable sinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Dre-nls (JDW 1131)
Plasmid#229809PurposeA CAGGS-driven dre recombinase followed by a c-terminal 1x nls sequenceDepositorInsertDRE recombinase-nls
TagsSV40 NLSExpressionMammalianPromoterCAGAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2t-CAF1-C-10
Plasmid#231782PurposeVisualization of nucleus in mammalian cells using mGold2tDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmGold2t-CAF1-C-10 (Chaf1a Mouse)
TagsmGold2sExpressionMammalianPromoterCMVAvailable sinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-Ku70
Plasmid#207547PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous Ku70 locus.DepositorInsertHaloTag with flanked by human Ku70 locus sequences
TagsHaloTagExpressionMammalianAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_GNB1L_dTAG
Plasmid#224378PurposeGenerates GNB1L dTAG C terminal knock-in cell linesDepositorAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E-EFS (EF1a core) (JDW 1319)
Plasmid#224474PurposeGateway compatible 5' entry clone with human alpha 2 globin pause site (to prevent transcription readthrough) and EF1a core promoter. Lacks downstream intron for a lower-activity, compact promoter.DepositorInsertEFS promoter
ExpressionMammalianAvailable sinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-LexA-mODC-LexOP-c-Fos (JDW 1359)
Plasmid#224506PurposeGateway compatible middle entry clone containing a Destablized LexA and LexOperon with 3' minimal c-Fos promoter for an all in one RU486 driven gene expression constructDepositorInsertLexA-oMDC-LexOP-c-Fos
UseGateway CloningAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV(T9)-DERA-sgresis
Plasmid#222622PurposeLentiviral vector that expresses sgRNA resistant DERA in mammalian cellsDepositorAvailable sinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEB018
Plasmid#215568PurposeFuses insert of interest to an HA-tag, stop codon and S. commune Hom2 terminator, with flanks directing the construct to S. commune targeted integration locusDepositorInsert3 x Hemagglutinin (HA) Tag / Stop codon / Intron / Hom2-terminator
UseFungal homologous recombination plasmidAvailable sinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only