We narrowed to 7,082 results for: mCherry
-
Plasmid#244816PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mCherry-labeled GAP43 Membrane Anchor (MEME) TagDepositorInsertmCherry
UseIn-vitro mrna synthesisTagsGAP43 Membrane Anchor (MEME) TagMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-mCherry-CAAX
Plasmid#223674PurposeAAV expression of mCherry from hSyn1 promoterDepositorInsertmCherry-CAAX
UseAAVPromoterhSyn1Available SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TVMV Protease-mCherry
Plasmid#243794PurposeEncodes for mammalian expression of TVMV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV protease
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-mCherry GAC
Plasmid#227830PurposeTo amplify the virus that expresses C-mCherry GACDepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AGG1983 UbL40-mCherry
Plasmid#242440PurposeAe aegypti UbL40 promoter expressing mCherryDepositorInsertmCherry
ExpressionInsectAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48A)-mCherry
Plasmid#193635PurposeExpresses S48A phosphodead VAMP3 fused to mCherryDepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationchanged serine 48 to alaninePromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-RILPL1 (R293A)
Plasmid#244981PurposeExpress RILPL1 in mammalian cells with mCherry tag expressing a R293A mutationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 delta mcherry
Plasmid#230940Purposenon-targeting Reference Control; expresses mCherryDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only