We narrowed to 4,170 results for: spl
-
Plasmid#231931PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆Hel_-3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of HelPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆QPG_-3xFLAG
Plasmid#231932PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆QPG_-3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of QPGPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆RNA1-2_-3xFLAG
Plasmid#231933PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆RNA1-2_-3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of RNA1-2PromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆polar_-3xFLAG
Plasmid#231934PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆polar_3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutation∆polarPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆C-term_-3xFLAG
Plasmid#231936PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆C-term_3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of C-termPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆RNA3_-3xFLAG
Plasmid#231937PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆RNA3_3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of RNA3PromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_3xFLAG
Plasmid#247230PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF+Hel_3xFLAGDepositorInsertZNF207-ZnF+Hel (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_K42E_3xFLAG
Plasmid#247231PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207-ZnF+Hel_K42E_3xFLAGDepositorInsertZNF207-ZnF+Hel_K42E (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_K42M_3xFLAG
Plasmid#247232PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF+Hel_K42M_3xFLAGDepositorInsertZNF207-ZnF+Hel_K42M (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_K42R_3xFLAG
Plasmid#247233PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF+Hel_K42R_3xFLAGDepositorInsertZNF207-ZnF+Hel_K42R (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable sinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN-miR122 TS
Plasmid#209787PurposeExpresses TadA8e and SpRY cas9N by the specific TNT4 promoter and incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertTNT4, TadA8e, SpRY N, inteinN, miR122 TS
UseAAVPromoterTNT4Available sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-NTEV-TCS-GV-2xHA
Plasmid#194371PurposeSplit TEV assaysDepositorInsertSP-AVPR2-NTEV-TCS-GV-2xHA (AVPR2 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_AVPR2-V2R-NTEV-TCS-GV-2xHA
Plasmid#194372PurposeSplit TEV assaysDepositorInsertAVPR2-V2R-NTEV-TCS-GV-2xHA (AVPR2 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194361PurposeSplit TEV assaysDepositorInsertSP-DRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-C-SH2
Plasmid#111419Purposeexpress murine Syk (C)SH2 domain (His 162 to Gln 264), in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (C)SH2 domain (His 162 to Gln 264), without any tag (Syk Mouse)
ExpressionBacterialPromoterT7 promoterAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-N-SH2+IA
Plasmid#111273Purposeexpress murine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site (Syk Mouse)
TagsHHHHHHENLYFQGExpressionBacterialPromoterT7 promoterAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_K36E_R38E
Plasmid#65095PurposeDestination vector with RBPMS with K36E/R38E mutation for stable cell line generationDepositorPublicationInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchange lysine 36 to glutamic acid and arginine 38…PromoterCMV, 2x TetAvailable sinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only