We narrowed to 2,467 results for: PUC19
-
Plasmid#222867PurposeThis plasmid codes for the guide of the OgeuIscB with a CAG targetDepositorInsertOgeuIscB omega RNA with a (CAG)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-PlmCasX-T2A-EGFP
Plasmid#188273PurposeMammalian expression, Genome editingDepositorInsertPlmCasX
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZNF561-donor
Plasmid#113801PurposeCRISPR donor plasmid to tag human transcription factor ZNF561 with GFPDepositorInsertZNF561 homology arms flanking EGFP-IRES-Neo cassette (ZNF561 Human)
UseCRISPRAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF700-donor
Plasmid#112385PurposeCRISPR donor plasmid to tag human transcription factor ZNF700 with GFPDepositorInsertZNF700 homology arms flanking EGFP-IRES-Neo cassette (ZNF700 Human)
UseCRISPRAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF169-donor
Plasmid#112376PurposeCRISPR donor plasmid to tag human transcription factor ZNF169 with GFPDepositorInsertZNF169 homology arms flanking EGFP-IRES-Neo cassette (ZNF169 Human)
UseCRISPRAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF227-donor
Plasmid#112368PurposeCRISPR donor plasmid to tag human transcription factor ZNF227 with GFPDepositorInsertZNF227 homology arms flanking EGFP-IRES-Neo cassette (ZNF227 Human)
UseCRISPRAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTX1-donor
Plasmid#112364PurposeCRISPR donor plasmid to tag human transcription factor OTX1 with GFPDepositorInsertOTX1 homology arms flanking EGFP-IRES-Neo cassette (OTX1 Human)
UseCRISPRAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBP1-donor
Plasmid#112336PurposeCRISPR donor plasmid to tag human transcription factor HBP1 with GFPDepositorInsertHBP1 homology arms flanking EGFP-IRES-Neo cassette (HBP1 Human)
UseCRISPRAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN118
Plasmid#91645PurposeExpress sgRNA targeting human MPP6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only